Specimens were examined using Leica® M205 C and DM750 microscopes. Habitus photos were taken by a Canon EOS 760D digital camera with a Canon MP-E65 macro lens or Olympus OM-D E-M1 digital camera with an Olympus M.Zuiko Digital ED 30mm F3.5 Macro lens. Other detailed photos were taken with a Leica MC170HD digital camera through a Leica® DM750 microscope. All the photos were stacked using the auto montage software Helicon Focus 7.0. After dissection, the adult specimens were mounted on cards or deposited in 75–95% ethanol. The larvae were killed, examined and preserved in 95% alcohol. Line drawings were prepared using the Clip Studio software, Adobe Illustrator CS5, and Adobe Photoshop CS5. The dots and gray areas are indicated for membranous parts and the cross-section.

The first instar larvae are recognized by their less sclerotized body wall, smaller size, rounded head, and presence of only two spines on the tarsungulus. The second and third instars are very similar, both having a more sclerotized body wall, larger size, and slightly elongated head. However, the only difference between L2 and L3 might be the larger size of the head capsule in L3. The descriptions are primarily based on sequenced specimens, but other identical (thus conspecific) larvae found in the same or similar samples are also considered. The terminology for larval morphology follows Pietrykowska-Tudruj and Staniec (2012). Due to the fragmented knowledge of the Staphylinidae and Staphylinini larvae, we do not homologize all chaetotaxy elements in our descriptions to avoid an incorrect understanding of homology, which may lead to problems discussed by Solodovnikov (2007). Also, Hu et al. (2020) indicated that even within Staphylininae there are various approaches to describe chaetotaxy. At most, we attempted to make our description of chaetotaxy as compatible with other descriptions of contemporary workers as possible. The specimens were measured using a Leica MC170 HD digital camera with software LAS (Leica Application Suite Version 4.4.0, Leica, Wetz­lar, Germany) through the computer. Measurement methods were modified from Pietrykowska-Tudruj and Staniec (2012), as follows: Body length—from anterior margin of nasale to the end of pygopod, taken from dorsal view; Head length—from anterior margin of nasale to neck; Head width—maximal width; Pronotum length—along the median line; Pronotum width—maximal width; Mesonotum length—along the median line; Mesonotum width—maximal width; Metanotum length—along the median line; Metanotum—maximal width; Urogomophi length—maximal length of urogomophi; Abdominal segment X length—from its anterior margin to its posterior margin. All measurements are in millimeters and reported in the “mean (minimum-maximum)” format.

FSHC – Fang-Shuo Hu collection, Yilan, Taiwan — NMNS – National Museum of Natural Science, Taichung, Taiwan (Bao-Cheng Lai) — NHMD – Natural History Museum of Denmark, Copenhagen, Denmark (Alexey Solodovnikov)

Genomic DNA was extracted from the adults of T. fratrumelliotorum and its putative larvae using the NautiaZ Tissue DNA Mini Kit (Nautia Gene Company, Taipei City, Taiwan) following the manufacturer’s protocol, but with adapted incubation times and temperatures (20 hours with T1 Buffer + proteinase K; stand at 25°C for 3 minutes after adding Elution Buffer). The 5ʹ fragment of the cytochrome oxidase I (cox1) mitochondrial gene was amplified using LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) primers (Folmer et al. 1994) with the following PCR protocol: 94°C for 3 mins, 40 × (94°C for 0:30 min, 47°C for 0:45 min, 72°C for 1:00 min), 72°C for 8 mins. The forward and reverse sequences were aligned and fitted to our primers. After alignment, the consensus sequences were checked for potential sequencing errors (ambiguous calls) and were manually edited. The forward and reverse sequences were assembled and edited in Geneious (v. 9.1). The matrix of genetic distances was calculated using Compute Pairwise model with MEGA X (Kumar et al. 2018) to provide accurate identification. The sequences were uploaded to the Barcode of Life Database (BOLD; Ratnasingham and Hebert 2007) under BOLD process IDs REICH008-25 to REICH012-25.

The cox1 barcoding fragment was sequenced from the two adults of T. fratrumelliotorum and three co-occurring putative larvae. The analysis shows that the sequences of all specimens are nearly identical (d ≤ 0.01) (Table 3), confirming that the larvae are conspecific with the adults.

3.2. Larval description for Tolmerinus fratrumelliotorum Rougemont, 2017

Figures 1, 2, 3, 4, 5, 6

Material examined.

TAIWAN: Kaohsiung City: Altogether the examined material includes eighteen larvae (three specimens of L1, thirteen specimens of L2 and two specimens of L3) and eight adults as follows: 5 adults (3 males and 2 females), Zuoying district (左營區), Banpingshan (半屏山), SW slope, 100 m, 22.694262, 120.305072, 9-22.vii.2021, M. Fikáček lgt. by squid-baited pitfall traps, TW2021-06d (FSHC, NMNS, NHMD); L2, 1 spec.; 3 female adults, Zuoying district (左營區), Banpingshan (半屏山), SW slope, 100 m, 22.694296, 120.305797, 22.vii.2021, M. Fikáček lgt. by sifting leaf litters, TW2021-06e (NHMD); L1, 1 spec., L2, 3 spec., L3, 1 spec., same locality as the previous one, 30.v.2023, BP8 (NHMD); L2, 3 spec.; L1, 1 spec., Zuoying district (左營區), Banpingshan (半屏山), SW slope, 90 m, 22.693469, 120.304979, 13.vi.2021, M. Fikáček lgt. by sifting leaf litters, TW2021-06 (NHMD); L1, 1 spec., L2, 2 spec., same locality as the previous one, 30.v.2023, BP10 (NHMD). Nantou County: L1, 1 spec., Huisun Forest reserve, track to Xiaochushan Mt., 24.0744602N, 121.0366337E, 1150 m, 16.viii.2021, Fikáček & Liang lgt. by sifting leaf litters, 21-08-HS1 (NHMD); L3, 1 spec., same locality and date as previous one, 21-08 HS1001-1 (extracted voucher, FS026L) (NHMD); L2, 1 spec., same locality and date as previous one, 21-08 HS1001-2 (NHMD); L1, 1 spec., Huisun Forest res., Wading trail, 24.0892139N, 121.0297836E, 700m, 17.viii.2021; Fikáček & Liang lgt. by sifting leaf litters (NHMD). Taichung City: L2, 3 spec., Wufeng, Beikeng Creek trail 24.045 120.7827, 410 m, 24 May 2023, FS Hu, YJ Chen, TW2023-018, lowland tropical forest with large accumulation of leaf litter and sparse understory, Taiwan Leaf Litter Beetles Project Additional specimens, WF1-08 (NHMD).

Figure 1. 

The habitus and aedeagus of adult Tolmerinus fratrumelliotorum. A: Habitus; B, D: aedeagus in parameral view. C: aedeagus in lateral view. Scale bars: 0.5 mm.

Description of the third instar larva (L3).

Measurements (in mm, n = 2): Body length: 12.21 (11.83–12.73); head width (HW): 1.43 (1.35–1.49); head length: 1.48 (1.38–1.53); pronotum width: 1.34 (1.27–1.42); pronotum length: 1.42 (1.33–1.52). — Habitus: Body slender, with relatively large head and long, slender legs, prothorax slightly wider than head, gradually wider posteriorly, mesothorax and metathorax slightly wider than prothorax and abdominal segments. Color: head and pronotum dark yellowish-brown, mandibles darker, thorax gradually darkening from mesonotum to metanotum, abdominal tergites I–IX same as metanotum, abdominal sternites I–IX yellowish-brown. Antennae, maxillae, labium light yellowish-brown. Basal part of urogomphi and abdominal tergite and sternite X dark brown but slightly lighter than abdominal tergites I–X, apical part of urogomphi yellowish-brown. — Head: Head capsule weakly transverse, slightly expanded from base anteriad, widest at stemmata level, with distinct pair of epicranial glands. Neck presents as distinct carina-delimited constriction. Each side of head with 4 pigmented stemmata in cluster, anterior two similar in size, slightly larger than upper-posterior one; lower-posterior one indistinct, almost indistinctive. Epicranium with five pairs of macro and five pairs of micro setae located symmetrically, divided by dorsal ecdysial line, two pairs of small pores located before epicranial dorsal setae, three pairs of posterior setae and one pair of posterior pores on posterior area; head chaetotaxy as in Fig. 3A. Nasale (Fig. 3C) with one pair of glandular pit and olfactory organs (Fl1), anterior margin of nasale with nine teeth, median tooth short, at same level as lateral teeth one, paramedian teeth longer than other teeth, lateral teeth two slightly shorter than paramedian teeth but longer than lateral teeth one and two, lateral teeth three short, slightly expanding to outer margin; setation on teeth symmetrical, with nine to ten pairs of macro setae and two to three pairs of micro setae. Head ventrally with 5 pairs of macro and 3 pairs of micro setae located symmetrically, divided by ventral ecdysial suture (Fig. 3B). Apotome triangular, both sides anteriorly membranous, median part sclerotized, with narrow and long stalk extending beyond tentorial pits; one pair of macro setae in front of stalk, two pairs of micro setae anteriorly. Tentorial pits large and oval. Ventral ecdysial line with small median spindle-shaped sclerite near its middle. Antennae four-segmented, slender; segment I cylindrical, shorter than other segments; segment II longer than segment III, slightly swelled in anterior part; segment III longer than segment IV, distinctly swelled in middle of its inner part; segment IV more slender than other segments, slightly longer than segment I, membranous apically, with three solenidia in one cluster; segment II with three macro setae; segment III with three macro setae and with apically pointed sensory appendage, with one small pore in its inner part near sensory appendage, with one solenidium behind small pore (Fig. 4D). Mandibles slender, apically blunt, with one seta externally at base, two campaniform sensilla dorsally of which one located in 1/3 base of mandible in middle, another located in 1/2 from base at external margin; with one campaniform sensillum ventrally, located in 1/2 from base in middle (Fig. 4B). Maxillae with cardo slightly shorter than stipes, about 1.5 times wider than stipes, with one seta in anterior part of outer margin; stipes with nine setae, one on outer margin in middle distinctly longer than others, one near distinctly longer seta, two located near base of outer margin, two near middle of inner margin, another three evenly dispersed along with anterior part of inner margin; mala digitiform, slender and long, with two setae dorsally, one near base of inner margin, one near middle of outer margin, four solenidia in one cluster apically; palpifer with one seta dorsally, near inner margin; maxillary palps four-segmented, segments I, II and III almost equally wide, segment IV slightly narrower; segment II distinctly longer than others, segment III slightly longer than segment I, segment IV fusiform, shorter than other segments; segment II with two setae, one near middle of inner margin, another located in anterior part of outer margin, segment III with one pore, located near base of outer margin (Fig. 4A). Labium with well-sclerotized ventral side of prementum, slightly membranous anteriorly, with pair of setae apically located on anterior margin of well-sclerotized part; labial palps three-segmented, segment I distinctly longer and wider than segments II and III, segment II longer than segment III, segment III fusiform, shorter than other segments; ligula very long, can be divided into two halves, one half sclerotized with one pair setae in anterior part of outer margin, another half membranous with seven solenidia separated apically (Fig. 4C). — Thorax: Prothorax longer than wide, meso- and metathorax wider than long, mesothorax slightly longer than metathorax; protergite with posterior carina, meso- and metatergite with anterior and posterior carinae. Thorax dorsally with mid-longitudinal ecdysial line. Thorax with simple macro or micro setae, without frayed setae (except on legs); chaetotaxy of pro-, meso-, and metanotum as shown in Fig. 5A. Cervicosternum large, triangular, with four pairs setae, two pairs near anterior suture of cervicosternum, one pair in middle of cervicosternum near ecdysial line, one pair on its posterior margin. Sternite of prosternal area trapezoid; with pair of setae near anterior margin (Fig. 5B). Spiracle oval. Legs (Fig. 5F) long and relatively slender; fore femora with about 22 spine-shaped setae, with longitudinal furrow medially, seven pairs of setae located along this furrow; foretibia with about 18 spine-shaped setae, 15 bifid setae located from its middle to anterior part in form of two or three clusters; tarsungulus with three spine-shaped setae (Figs 5C–D). — Abdomen: Abdominal segments with visible dark sclerites, with large or small frayed setae and long or short simple setae. Segment I with pair of paratergites and parasternites fused to each other. Segments II–VIII with pair of paratergites and pair of parasternites (Fig. 5D). Sternite I strongly reduced and of irregular shape, less sclerotized than other segments (Fig. 5E). Chaetotaxy of segment I simpler than more even serially homologous chaetotaxy on segments II–VIII (Fig. 5C–E). Segment IX with reduced chaetotaxy, without laterosclerites or ecdysial line. Segment X (pygopod) with about 24 relatively short spine-shaped setae dorsally and 16 relatively long spine-shaped setae ventrally, all setae located asymmetrically (Figs 6A–B). Urogomphi likely two-segmented (no complete specimen of mature larvae, the segmentation is inferred from early instars only), very long, at least four times as long as abdominal segment IX; first half of segment I straight, with about 30 relatively short setae; second half of segment II formed at least by eight cylindrical pseudosegments, each bearing three very long setae, these setae becoming gradually longer from base to apex of the segment (Fig. 6C).

Figure 2. 

Habitus of first and third instars of larvae of Tolmerinus fratrumelliotorum. A: first instar. B: third instar. Scale bars: A, 1 mm; B, 2 mm.

Figure 3. 

Head and nasale of the third instar larva of Tolmerinus fratrumelliotorum. A: head in dorsal view. B: head in ventral view. C: nasale in dorsal view. Scale bars A, B: 0.5 mm; C: 0.2 mm. Abbrevations: Ap, apotome. Des, dorsal ecdysial suture. E, epicranial part. Ed, epicranialodorsal seta. Em, epicranial alomarginal seta. Ep, epicranial pore. Fl, frontal lateral seta. Fm, frontal marginal seta. Gp, glandular pit. L, lateral; Lt, lateral teeth. Mt, median tooth. Na, nasale. P, posterior part. Pmt, paramedian tooth. Pp, posterior pore. Tp, tentorial pit. V, ventral part. Ves, ventral ecdysial suture. Vl, ventrolateral seta. Vm, ventral marginal seta.

Figure 4. 

Head appendages of the third instar larva of Tolmerinus fratrumelliotorum in dorsal view. A: maxillary palps. B: mandible. C: labium. D: antenna. Scale bar: 0.2 mm. Abbrevations: Cd, cardo. Cs, dorsal sensillum. Lg, ligula. Ma, mala. Pf, palpifer. Pmn, prementum. Sa, sensory appendage. St, stipes.

Figure 5. 

Thorax, forelegs and abdominal segments I and II of the third instar larva of Tolmerinus fratrumelliotorum. A: thorax, in dorsal view. B: prothorax, in ventral view. C: abdominal segments I and II, dorsal view. D: same in lateral view proleg, in latero-ventral view. E: same in ventral view. Scale bars: A, 1 mm; B-E, 0.5 mm. Abbrevations: Cc, coxal cavity. Cr, cervicosternum. Fe, femora. Pro, prothorax. Meso, mesothorax. Meta, metathorax. Sn, sternite. Sp, spiracle. Tb, tibia. Tr, trochanter. Tu, tarsungulus.

Figure 6. 

Abdominal segments IX and X of the first and third instars larva of Tolmerinus fratrumelliotorum. A: abdominal segments IX and X of third instar, in dorsal view. B: same in ventral view. C: same structures of first instar, in lateral view. Scale bars: 1 mm. Abbreviations: Ugl: urogomphi.

The difference between larval instars.

Measurements for the first instar larva (L1) (in mm, n = 5): Body length: 5.73 (5.24–6.29); head width (HW): 0.94 (0.92–0.98); head length: 0.77 (0.67–0.83); pronotum width: 0.91 (0.86–0.94); pronotum length: 0.67 (0.64–0.68). — Measurements for the second instar larva (L2) (in mm, n = 11): Body length: 6.83 (6.10–7.38); head width (HW): 1.01 (0.93–1.05); head length: 0.91 (0.80–1.00); pronotum width: 0.84 (0.78–0.91); pronotum length: 0.86 (0.82–0.92).

L3 (see measurements above in the description) is larger than L1 and L2. The whole body of L1 is pale-yellow and less sclerotized than in L2 and L3. Habitus of L2 is similar to L3. Mandibles in L1 are relatively sharper and more sclerotized in the apical half of mandibles than in L2 and L3. Apotome stalk absent in L1, but present in L2 and L3; ventral ecdysial lines of L1 very short without median spindle-shaped hole, L2 and L3 with median spindle-shaped hole on the second half of ecdysial line. The bifid setae of foretibia present in L2 and L3 but absent in L1. Tarsungulus with only two spines in L1, but three spines in L2 and L3.

Biology.

Adults and larvae of Tolmerinus fratrumelliotorum were collected together from various habitats. In secondary forests with Ficus, they were found using squid-baited pitfall traps. In karst areas, they were collected by sifting through shallow leaf litter accumulations, which often included wood debris, fungi, and fallen fig fruits. In primary forests on slopes with sparse understory, the species was located by sifting through leaf litter accumulations, which may also contain fungi and mammal excrement. Additionally, the species was collected from small leaf litter accumulations in stony forests on mountain slopes. Interestingly, three sequenced specimens of T. fratrumelliotorum were contaminated by DNA of Burmaniscus isopods, which may indicate that Tolmerinus adults and larvae prey on terrestrial isopods.

Distribution.

Tolmerinus fratrumelliotorum is known from the type specimens collected in Hong Kong, China (Rougemont 2017) and is now reported from Taiwan for the first time. Our data indicates that it may be widespread in Taiwan.

Remarks.

Matějíček and Boháč (2020) indicated T. auronotatus Fauvel, 1895 to occur in Taiwan, based on the catalogue of Herman (2001). However, Herman (2001) only listed the species for Myanmar. Therefore, Tolmerinus fratrumelliotorum is at the moment the only species of the genus known in Taiwan. Additional species of Tolmerinus were collected by us during the Taiwanese Leaf Litter Beetles Barcoding project (Hu et al. 2024). The identifications of these species will be published in future papers.

We obtained three most parsimonious trees from the IWMP analysis of immature characters, with a length of 233 steps. The topology of our strict consensus tree (Fig. 7) differs from the 50 % majority rule consensus tree in Li and Tang (2024) in the relationships among Quediina (Quedius Casey, 1915 spp.), Acylophorina (Acylophorus Nordmann, 1837 and Anaquedius Casey, 1915), Cyrtoquediina (Astrapaeus Gravenhorst, 1802) + Antimerina (Antimerus Fauvel, 1878), Heterothops Stephens, 1829 spp. (Amblyopinina), and Erichsonius Fauvel, 1874 spp. (Erichsoniina). Our strict consensus tree reveals that Anisolinina (represented by Tolmerinus fratrumelliotorum) is not the sister group to Staphylinina as suggested by most previous molecular or adult morphology-based phylogenies. Instead, Anisolinina forms a clade with Algonina (Algon Sharp, 1874), Xanthopygina (Xanthopygus spp.) and Philonthina (represented by several genera) with unresolved relationships among all four subtribes. That big clade containing Anisolinina is sister to ‘Quedius’ ‘antipodum (i.e., part of Amblyopinina). The subtribe Staphylinina is monophyletic and is sister to the latter clade containing Anisolinina and ‘Quedius’ ‘antipodum. In addition to the mentioned non-monophyly of Amblyopinina, this analysis does not reveal Quediina as monophyletic and it contradicts with the well-established backbone topology of Staphylininae and Staphylinini in intertribal and intersubtribal sister-group relationships. The tree topology in Fig. 7 shows a significant conflict with the rather well-established reference phylogeny of the group by Reyes-Hernández et al. (2025) in not resolving Staphylinini and Tanygnathinini as monophyletic sister tribes, not resolving monophyletic Quediina, Amblyopinina, and in other details.

Figure 7. 

Strict consensus tree reconstructed by parsimony analysis under implied weights (IWMP) using TNT for the immature morphological data of 41 taxa and 71 characters. Characters plotted using unambiguous optimization, their numbers indicated above the circles, their state numbers below the circles. Black character circles at tree branches represent unique synapomorphies, and white character circles indicate homoplasies; black squares after subtribal name indicate members of the tribe Staphylinini, white squares after subtribal name indicate members of the tribe Tanygnathinini. Character matrix from Li & Tang (2024), with addition of Tolmerinus fratrumelliotorum here.

When we mapped characters of the immature stages onto the reference tree by Reyes-Hernández et al. (2025), expectedly, the tree became longer by having 275 steps. Also, no synapomorphies shared between Anisolinina and Staphylinina were found given this set of characters (Fig. 8). However, some synapomorphies were revealed in support of various other clades. For instance, the presence of spine-like setae on the dorsal side of the front tarsungulus (44/1) supports the sister group relationship between Staphylinini and Tanygnathinini, although this character is secondarily lost in the Platydracus group (Staphylinina). The tribe Staphylinini is supported by the chaetotaxy of the abdominal sternites II–VIII consisting only of the frayed or club-shaped setae (53/0), however, this character has secondary modifications in many ingroup taxa. The subtribe Tanygnathinina is supported by several characters: tentorial pits on the head capsule positioned posteriorly (10/2), the epicranial gland on the head is absent (12/1), and the main sensory appendage of the antennae with the sclerotized band absent (18/1). In Acylophorina, the digitiform sensory appendage on the maxillae is located anteriorly, closer to the apex (32/1). The clade (i.e. Staphylinini propria) comprising Xanthopygina + Philonthina as sister to Algonina + (Anisolinina + Staphylinina) is supported by multiple characters, including the presence of setae on the inner margin of the second maxillary segment located in the middle (20/1); U-shaped lateral sclerites formed by abdominal paratergites and parasternites of segment I (50/2); the presence of setiform projections on the pronotum of the pupa (62/0); and setiform cuticular processes on the sides of the abdominal segments of the pupa (66/0). The Platydracus group, as proposed by Brunke and Smetana (2019, 2020), is supported by the absence of terminal prolongations on segment IX of the pupa (67/1).

Figure 8. 

Reference phylogenetic tree of Staphylininae using our taxon sampling and topologyfrom Reyes-Hernández et al. (2025). Characters plotted using unambiguous optimization, their numbers indicated above the circles, and state numbers below the circles. Black character circles at tree branches represent unique synapomorphies, white character circles indicate homoplasies, node marked by black square represents the tribe Staphylinini clade, node marked with white square represents the tribe Tanygnathinini clade. Character matrix from Li & Tang (2024), with addition of Tolmerinus fratrumelliotorum here.

One striking character of the Tolmerinus larva is very long urogomphi, with its second segment formed by multiple pseudosegments, each with very long setae. This form of urogomphi may represent a synapomorphy of Anisolinina, but it needs to be confirmed once larvae of other genera within the subtribe are studied. The character was not included in the character matrix of Solodovnikov and Newton (2005), so we cannot confirm it for Diatrechus, the only other genus of Anisolinina with known larvae. Long urogomphi are also found in some Philonthina, Staphylinina, and Xanthopygina, but pseudosegments are not present in these larvae. The Tolmerinus larva is generally similar to the larvae of Staphylinina, especially those from the Ocypus group, in the combination of 4 segmented of maxillary palps, 3 segmented of labial palps, presence of bifid setae on tibia forming a cluster, and 3 setae on tarsungulus. However, it can be distinguished by relatively slender and long legs, and paratergites and parasternites of the first abdominal segment merged into U-shaped lateral sclerites.

The sister-group relationships of Anisolinina with other lineages of Staphylinini remain unresolved based on characters of the immature stages, and none of such characters appear synapomorphic for the Anisolinina + Staphylinina clade suggested by other character systems. This may be due to the missing egg and pupal character data for Anisolinina, particularly as pupal characters have been highlighted as valuable for understanding phylogenetic relationships within Staphylinini (Staniec and Pietrykowska-Tudruj 2019; Li and Tang 2024). Notably, characters such as the dense band of aeropyles on the eggs (3/3) and the curved apical appendages on the pupae (69/1) were found to support the monophyly of Staphylinina in the unambiguously optimized tree by Li and Tang (2024). However, these characters were neither resolved as synapomorphies on our IWMP tree in Fig. 7, nor on the well-established reference phylogeny in Fig. 8.

It is worth mentioning the issue regarding the relationship between Cyrtoquediina (Astrapaeus) and Antimerina (Antimerus). Pietrykowska-Tudruj et al. (2014b) found several synapomorphies shared by these two taxa, suggesting a close relationship and placing them as a basal grade of Staphylinini, consistent with the hypothesis proposed by Brunke and Solodovnikov (2013). Both Li and Tang (2024) and our morphological analysis also found some synapomorphies between them. For instance, the presence of frayed or club-shaped setae on the head capsule (11/1) and numerous short setae on the protibia (36/1) are unique synapomorphies supporting this clade. This contradicts with molecular phylogenies that indicate that Cyrtoquediina and Antimerina are phylogenetically distant lineages (Żyła and Solodovnikov 2019; Reyes-Hernández et al. 2025), and that the above mentioned characters evolved independently in both groups. To clarify this, their examination has to be done under higher magnification or SEM (e.g., Staniec and Pietrykowska-Tudruj 2008a, figs 5–11), and more larvae have to be discovered and described, to detect possible minute difference that often exist if the same character state evolved independently. Because of the issues addressed in Solodovnikov (2007), a careful homology-based assessment of many similarly looking structures, especially chaetotaxy, is needed to properly evaluate their evolution.

Our analysis identifies 34 unique synapomorphies in the phylogenetic tree obtained by the analysis of the morphological matrix built for immature stages (Fig. 7) and 21 unique synapomorphies when the same character set is mapped on the reference phylogeny (i.e., the phylogenomic tree assessed through consistency with the adult morphological characters: Fig. 8). Most of the synapomorphies are the same in both trees where they support the same clades. However, two characters, chaetotaxy of abdominal sternites II–VIII consisting only of frayed or club-shaped setae (53/0) and the presence of setae on the middle of the inner margin of the second maxillary segment (20/1), are optimized as synapomorphies only in the reference tree. The character 53/0 supports the monophyly of the tribe Staphylinini which is well established with the multi-locus, phylogenomic, and adult morphology data; while the character 20/1 supports the monophyly of a large clade within Staphylinini, first well established in earlier phylogenies as “Staphylini propria”. Presumably, these two larval characters are phylogenetically important but their impact in the phylogenetic tree in Fig. 7 was outweighed by other characters, as discussed above for the characters 11/1 or 36/1. Similarly to characters 11 and 36, some other synapomorphies in the tree in Fig. 7, such as the digitiform sensory appendage on maxillae located anteriorly and closer to the apex (21/1), abdominal sternites II–VIII with both frayed or club-shaped setae and simple setae (53/1), pygopod moderately long (59/1), and the presence of cuticular processes on the sides of abdominal segment VIII in the pupa (65/0), appear to support sister group relationships among unrelated taxa. These characters likely need re-evaluation, before being used in phylogenetic analyses.

Recent practice shows that phylogenomics is the most efficient way for phylogeny reconstruction, including for Staphylininae (e.g., Brunke et al. 2021; Hansen et al. 2023; Reyes-Hernández et al. 2025). Even though larval characters are believed to be useful for phylogenetics of holometabolous insects and showed their utility in the phylogenetic studies of wider Coleoptera and Staphylinidae, they are difficult to observe and interpret, and they are missing for many genera and larger lineages. Many larval characters, especially chaetotaxy, require more in-depth morphological study before they are properly homologized and compared across taxa. Their understanding in taxonomic works, including those where very accurate and detailed comparative morphology has been done, may be still not sufficient to understand the homology. Additionally, our analysis shows that larval characters exhibit a high amount of homoplasy, making it difficult to accurately assess homologies. A similar case has been observed in other beetles (Archangelsky et al. 2020). Although phylogenomic data is powerful, systematic biases remain, such as compositional heterogeneity, missing data, branch-length heterogeneity, paralogy, heterotachy, and gene tree heterogeneity (Young and Gillung 2020). Morphological data can help identify such biases or determine which conditions are closer to reality (Wiens 2004). While there is no doubt that larval taxonomy is worthwhile for identification, larval characters also remain important for phylogenetic reconstruction if properly explored and described in the taxonomic literature, which is challenging.