Abstract

Triplectides Kolenati, 1859 (Leptoceridae) is the most diverse genus within Triplectidinae, with about 90 species worldwide, 18 of them in the Neotropics. Currently, eleven species are recorded from Brazil. Since Holzenthal’s 1988 revision, many additional specimens have become available, leading to a significantly broader known distribution for several Brazilian species of Triplectides. Consequently, the morphological boundaries between some species have become less distinct. Furthermore, despite the ecological importance of caddisfly larvae, the immature stages of only a few Brazilian species have been described to date. The present study has the following aims: to evaluate Triplectides species boundaries using morphology and DNA sequences (COI and EF-1α); describe probable new species; and use DNA-based life stages associations to recognize and describe larvae at the species level. We delimited and formally described seven new species of Triplectides: T. bandeira sp. nov., T. caparaoensis sp. nov., T. cerradoensis sp. nov., T. iguassu sp. nov., T. mantiqueira sp. nov., T. paragracilis sp. nov., and T. puri sp. nov. Additionally, we successfully associated adult males with the immature larval stages of seven Brazilian species, including both newly described and previously known species of Triplectides, for which we provide morphological descriptions.

Keywords

Aquatic insects, integrative taxonomy, immature stages, molecular association, Triplectidinae

1. Introduction

The long-horned caddisflies, Leptoceridae, constitute the second largest family in the order Trichoptera with around 2,300 currently known species (Morse et al. 2019). Four subfamilies are recognized (Malm and Johanson 2011), three of them occurring in the Neotropics, including the Triplectidinae (Holzenthal and Calor 2017). Triplectides Kolenati, 1859 is the most diverse genus within its subfamily, with about 90 species, and displays a wide distribution, mainly in southern hemisphere, occurring in Neotropical, Oriental, East Palearctic, and Australasian regions (Morse 2024). Most of the species are in the Australasian region, where more than 50 species are recorded (Morse 2024). In the Neotropical Region, Triplectides is currently represented by 18 species that occur from Mexico to Patagonia (Holzenthal and Calor 2017; Desidério et al. 2017, 2020). In Brazil, Triplectides is currently represented by eleven species (Table 1).

Table 1.

Download as

CSV

XLSX

Triplectides species recorded from Brazil (see Santos et al. 2025) and respective distribution in Brazilian states. The new species defined here and references for larval descriptions, when available, are provided. After molecular and morphological delimitation provided herein, distributions for species marked with asterisk (*) should be viewed with caution.

Species	Distribution in Brazilian states	Larval description
T. bandeira sp. nov.	Espírito Santo, Minas Gerais	Unknown
T. caparaoensis sp. nov.	Espírito Santo, Minas Gerais	This paper
T. cerradoensis sp. nov.	Minas Gerais, São Paulo	Unknown
T. cipo Henriques-Oliveira & Dumas, 2015	Maranhão, Mato Grosso [new record], Minas Gerais	This paper
T. egleri Sattler, 1963	Amazonas, Pará	Sattler (1963)
T. flintorum Holzenthal, 1988	Amazonas [new record from Brazil]	Unknown
T. gracilis (Burmeister, 1839)	Bahia, Espírito Santo, Minas Gerais, Paraná, Pernambuco, Rio de Janeiro, Santa Catarina, São Paulo (*)	Müller (1921) Sganga et al. (2013) This paper
T. iguassu sp. nov.	Paraná, Rio Grande do Sul, Santa Catarina	This paper
T. itatiaia Dumas & Nessimian, 2010	Rio de Janeiro, São Paulo [new record]	Unknown
T. mantiqueira sp. nov.	Minas Gerais, São Paulo	This paper
T. maranhensis Desidério, Barcelos-Silva & Pes, 2017	Maranhão, Pará, Piauí	Unknown
T. misionensis Holzenthal, 1988	Minas Gerais, Paraná, Rio de Janeiro, Santa Catarina, São Paulo (*)	Sganga et al. (2013)
T. neblinus Holzenthal, 1988	Amazonas, Roraima	Unknown
T. neotropicus Holzenthal, 1988	Espírito Santo, Minas Gerais, Pernam-buco, Rio de Janeiro, São Paulo (*)	Unknown
T. nessimiani Desidério & Pes, 2020	Amazonas	Unknown
T. nevadus Holzenthal, 1988	Amazonas	Unknown
T. paragracilis sp. nov.	Rio de Janeiro	Unknown
T. puri sp. nov.	Espírito Santo, Minas Gerais	This paper
T. ultimus Holzenthal, 1988	Espírito Santo, Minas Gerais, Rio de Janeiro (*)	This paper

Holzenthal (1988) provided a detailed taxonomic revision of the Neotropical species of Triplectides. The main features for identifying species are from the male genitalia, as usual for caddisflies, and additional diagnostic characteristics can be found in wing venation and tibial spur formula. Since Holzenthal’s revision, many more specimens were made available, extending the distribution of several Brazilian Triplectides species. At the same time morphological definitions became less clear. Variation in male genitalia among New World species can be very subtle and geographic distribution for some species can overlap. Consequently, identifying specimens from some localities, especially from southern and southeastern Brazil, and defining the boundaries between closely related species is challenging when using exclusively morphological data.

Beyond their taxonomic significance, caddisfly larvae are also ecologically important and are commonly used in biomonitoring studies of lotic environments as indicators of water quality. Along with mayflies (Ephemeroptera) and stoneflies (Plecoptera), they form the basis of the widely used EPT index (e.g., Barbour et al. 1999; Baptista et al. 2007; Gonçalves and Menezes 2011; Ceneviva-Bastos et al. 2017). Despite their abundance and ecological importance in freshwater systems environments, only about 9% of Neotropical species have had their larval stages associated and fully described morphologically (Pes et al. 2018). Triplectides larvae inhabit a wide variety of habitats, including both permanent and temporary lotic and lentic systems. They occur in a range of environmental conditions from pristine to moderately polluted waters (Morse and Neboiss 1982). The larvae are shredders and easily recognized by their cases, which are often constructed of a hollowed-out twig. Some species even use a discarded case from another trichopteran larva (Holzenthal and Calor 2017), confusing the inattentive observer.

Traditional methods to associate immatures to identifiable adults include: (1) rearing the larvae to obtain an adult or (2) the so-called metamorphotype method (Milne 1938) when a pharate adult with mature genitalia is collected. This allows the simultaneous identification of the adult based on the genitalia, and of the larva based on the larval sclerites found inside the pupal cocoon. The first option is usually time consuming and obtaining an adult male is not guaranteed. Conversely, the second option usually requires collecting large number of pupae and luck to find a pharate male. In both cases, larval association is indirect, since the entire larva is not associated (only its sclerites).

Currently, the use of molecular data is a common way to facilitate both species delimitation and life stage associations. This is particularly helpful when species identification using morphology alone is difficult or even impracticable, e.g. when delimiting cryptic species (Tierno-de-Figueroa et al. 2011) or larval association and identification (Zhou et al. 2007; Ruiter et al. 2013). For animals, a fragment of the mitochondrial cytochrome oxidase I (COI) gene, the so-called DNA-barcode, is the most used for this task (Zhou et al. 2011; Ruiter et al. 2013). For Trichoptera, COI sequences usually show a low intraspecific variation and high interspecific divergence, in other words, displaying a clear barcoding gap (Ruiter et al. 2013). In this sense, this molecular tool is useful for associating morphologically identified adults to unidentified immatures (Hogg et al. 2009; Zhou et al. 2011; Ruiter et al. 2013). Although studies using DNA to associate adult and immature stages have become common in some regions of the World (e.g., Waringer et al. 2008, Shackleton and Webb 2013; Ruiter et al. 2013), for Brazilian caddisflies, this type of study is still scarce (e.g., Santos et al. 2016; Barcelos-Silva et al. 2018).

Initially, this study aimed to associate and describe Triplectides larvae from Brazil using DNA barcoding. However, as the research progressed, it became clear that a more precise definition of the morphological boundaries among Brazilian Triplectides species was necessary. To address this, we conducted an integrative study combining morphological analyses and DNA sequence data (from both mitochondrial COI and nuclear EF-1α markers), using numerous adult and immature specimens collected from various regions of Brazil. As a result, we identified and described seven new species based on both morphology and molecular data from the two genetic markers. Additionally, we established adult–larva associations for seven Brazilian species, including both newly described and previously known taxa. Larvae of several of these species were formally described for the first time.

2. Material and methods

2.1. Collection, specimen preparation, and depositories

Specimens of eight previously defined species of Brazilian Triplectides were analyzed, covering three distinct biomes: the Amazon and Atlantic Rainforests and the Cerrado, the South American savannah. In addition, larvae and adults of another three species of Triplectides from Chile and Peru were also used for morphological and molecular comparisons.

Adults were collected using collapsible light traps (Nessimian et al. 2024) or Malaise traps, and larvae were collected manually in streams. All specimens were preserved in 80–96% ethanol. To observe genital structures, the abdomen was removed and cleared using a heated solution of 10% KOH or 85% lactic acid as described in Blahnik et al. (2007). Abdomens were temporally mounted on a slide with glycerin for viewing and drawing under a compound microscope, and then transferred to a microvial with 80% ethanol and stored together with the remainder of the specimen.

Types of species described herein and other material examined are deposited in the following institutions, as indicated in the species description DZRJ – Coleção Entomológica Professor José Alfredo Pinheiro Dutra, Departamento de Zoologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil; MNRJ – Coleção Entomológica, Museu Nacional, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil; MZSP – Museu de Zoologia da Universidade de São Paulo, São Paulo, Brazil; USNM – National Museum of Natural History, Washington, DC, USA; ZIUH – Zoologisches Institut der Universität, Halle an der Salle, Germany.

2.2. Illustrations and terminology

Pencil sketches genital structures were made under a compound microscope (Carl Zeiss, model Axiolab) equipped with a camara lucida. Sketches were scanned and placed in an Adobe Illustrator CS6 (Adobe Systems, Inc.) document and used as templates for graphic vector illustration. Photographs of wings and larvae were taken with a digital camera Leica Camera (DFC450) coupled to a Leica stereomicroscope (M205C). A series of photographs of each structure at different focal planes were stacked using the Leica Application Suite (Version 4.6.2).

Terminology for adult structures used here follow that of Holzenthal (1988) for males, Yang and Morse (2000) and Ito et al. (2013) for females, and Sganga et al. (2013) for immatures with minor modifications.

Abbreviations of morphological structures: ap. lo. = apicodorsal lobe; apm. go. pl. = apicomesal process of gonopod plate; bv. lo. = basoventral lobe; do.pr. = dorsal process; go. pl. = gonopod plate; lam. = lamella; me. lo. = mesal lobe; pr. ap. = preanal appendage; s-b p. = sensilla-bearing process; sp. sc. = spermathecal sclerite; 2nd art. = second article; VIII = Sternum VIII; IX = Tergum IX; X = Tergum X.

2.3. DNA extraction, amplification, sequencing, and alignment

Genomic DNA from specimens of Triplectides were extracted from legs and associated muscles of adults and larvae using a DNeasy® Blood and Tissue kit (QIAGEN Hilden, Germany). After extraction, legs were returned to ethanol with the remainder of the specimen, which is deposited in DZRJ collection as DNA voucher.

A fragment of the mitochondrial cytochrome oxidase I gene (COI) and a fragment of the elongation factor 1-alpha (EF-1α) were amplified with polymerase chain reaction (PCR) using the pairs of primers described in Table 2. PCR conditions were as follows: COI (initial denaturation at 95°C for 2 min; Hot start at 80°C for 20 min, 5 cycles of denaturation at 95°C for 30 s, annealing at 45°C for 1.5 min and extension at 72°C for 1 min; followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 51°C for 1.5 min and extension at 72°C for 1 min; and final extension at 72°C for 3 min); and EF-1α (initial denaturation at 94°C for 3 min; Hot start at 80°C for 20 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min and extension at 72°C for 2 min, and final extension at 72°C for 7 min).

Table 2.

Download as

CSV

XLSX

Primers used in PCR and sequencing reactions to generate sequences for Triplectides and other Leptoceridae analyzed here, with respective references.

Gene	Primer	Sequence 5’–3’	Source
COI	LCO-1490 (F)	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994)
COI	C1-J-1718 (F)	GGAGGATTTGGAAATTGATTAGTTCC	Simon et al. (1994)
COI	HCO-2198 (R)	TAAACTTCAGGGTGACCAAAAAATCA	Folmer et al. (1994)
EF-1α	FOR 3 (F)	GGNGACAAYGTTGGYTTCAACG	Danforth and Ji (1998)
EF-1α	CHO 10 (R)	ACRGCVACKGTYTGHCKCATGTC	Danforth and Ji (1998)

PCR products were puriﬁed and sequenced by Macrogen Inc. (Seoul, South Korea). Electropherograms were verified in Geneious 9.1.8 (Biomatters Ltd.), and forward and reverse strands were assembled in the same software to generate consensus sequences. COI and EF-1α sequences were aligned with ClustalW algorithm implemented in MEGA X (Kumar et al. 2018) and translated into amino acid sequences to check for correct alignment and the non-amplification of pseudogenes.

In total, 59 COI sequences were generated for Triplectides, 39 from adult males, 1 from an adult female, and 19 from larvae. For EF-1α, 56 sequences were generated, 37 from adult males, 1 from female, and 18 from larvae. In addition, we included 91 COI sequences and 23 EF-1α sequences of Triplectides (worldwide) and other Leptoceridae genera from GenBank® as outgroup taxa. The complete alignment of COI was 658 bp long with 150 sequences (135 from Triplectides) and of EF-1α was 360 bp long with 79 sequences (64 from Triplectides). Complete information about sequences analyzed here are provided in Table S1.

2.4. Species delimitation and phylogenetic analyses

We calculated divergences for both COI and EF-1α alignments in MEGA X. For the COI alignment, we used Kimura-2-Parameter (K2P) divergences, to be able to compare our results with previous data on literature, since this model has been widely used in species delimitation studies, including for Trichoptera (e.g., Ruiter et al. 2013; Santos et al. 2016; Barcelos-Silva et al. 2018). For the EF-1α alignment, we used simple p-distance. COI and EF-1α alignments were used individually to explore putative species limits using the Assemble Species by Automatic Partitioning (ASAP – Puillandre et al. 2021). We ran ASAP on the web version (https://bioinfo.mnhn.fr/abi/public/asap) using the K2P model for COI sequences and p-distance for EF-1α sequences to compute distances and the default settings for all other parameters. Since we did not extensively sample the outgroup, we included only sequences of Triplectides species for both COI and EF-1α alignments in the ASAP analysis. We also calculated a maximum likelihood (ML) tree using each gene alignment separately and a concatenated matrix with the software IQ-TREE v.2.2.0 (Nguyen et al. 2015) locally [command -p partition.nex --runs 10 -alrt 10000 -B 10000]. The ML tree search was performed with 10 IQ-TREE runs for each matrix analyzed. The nucleotide substitution models implemented in individual and combined analysis (COI: TIM2+F+I+G4, EF-1α: TIM2e+I+G4) were selected with ModelFinder (Kalyaanamoorthy et al. 2017) based on BIC scores in IQ-TREE. Ultrafast bootstrap approximation (UFBoot – Hoang et al. 2018) and Shimodaira–Hasegawa approximate likelihood ratio test (SH-aLRT – Guindon et al. 2010), both with 10,000 replicates, were used to assess branch support. The ML trees were rooted using the position of the Grumichellinae taxa (Atanatolica and Grumichella). The estimated ML tree for each gene fragment was used to infer putative species through the Bayesian version of the Poisson tree process (bPTP) model (Zhang et al. 2013). We ran the bPTP on the webserver (https://species.h-its.org), with all outgroup taxa (non-Triplectides) removed, for 500,000 generations with a 10% burn-in. For each analysis, likelihood plots were visually checked for convergence of the MCMC chains. The estimated ML tree for the concatenated matrix was used to summarize the results below. FigTree v.1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/) was used to view and edit trees, and Adobe Illustrator CS6 (Adobe Systems, Inc.) was used for final edition.

3. Results

3.1. Phylogenetic relationships

The maximum likelihood tree resulting from concatenated COI and EF-1α is presented in Figure 1 (the complete version is presented in Fig. S1), with the species recovered by ASAP and bPTP using each gene independently. The ML trees resulting from each gene, COI and EF-1α, separately are presented in Figs S2 and S3, respectively. In the Neotropical lineages of Triplectides, as defined in Figure 1, intraspecific K2P distances for COI were higher than 10% in five out of the 19 lineages examined (Table 3), reaching a maximum of 16.6%. The lineage of T. bandeira sp. nov., represented in the molecular analyses by three specimens (ENT0706, ENT0741, and ENT6327), exhibited maximum intraspecific K2P distances for COI of 10.2%. Two other, morphologically indistinguishable specimens, were recovered in a distinct lineage (ENT3223 and ENT6331 – Fig. 1), with high K2P distances from T. bandeira sp. nov. for COI (20.5%). This morphological group is treated here as belonging to the bandeira complex, since molecular data did not unambiguously support their belonging to T. bandeira sp. nov. Minimum interspecific K2P distances for COI sequences of the Neotropical lineages ranged between 8.7% and 16.7% (Table 3). Therefore, the highest intraspecific K2P divergences of COI for T. bandeira sp. nov., T. cipo, T. flintorum, T. itatiaia, and T. jaffueli were equal or higher than the lowest interspecific divergence observed (Table 3). For EF-1α sequences, the highest intraspecific p-distances were observed among T. caparaoensis sp. nov. sequences, with 7.8%, and one EF-1α sequence of T. caparaoensis sp. nov, was identical to sequences of T. mantiqueira sp. nov. Pairwise distances for COI (K2P) and EF-1α (p-distances) are presented in Tables S2 and S3, respectively.

Figure 1.

Maximum likelihood tree based on the concatenated COI and EF-1α nucleotide sequences (lnL = –19563.4365) analyzed in IQ-TREE. Only the clade including the neotropical lineages of Triplectides is presented, the small tree on the top left depicts the backbone of the entire ML tree, highlighting the shown clade. Numbers associated to branches are SH-aLRT > 85% / UFBoot > 75% support values. Bars on the right depict results of ASAP and bPTP (highest posterior probability supported delimitation) for COI and EF-1α respectively. — Abbreviations: ♂ – male; ♀ – female; L – larva. Only the specimens in which the sequences were generated here have the sexual forms identified.

Table 3.

Download as

CSV

XLSX

Maximum intra- and minimum interspecific K2P divergences of COI and p-distances of EF-1α sequences of Neotropical species of Triplectides after species delimitation provided here. N = number of sequences analyzed.

		COI			EF-1α
Species	N	max. intra.	min. inter.	N	max. intra.	min. inter.
T. bandeira sp. nov.	2	10.2%	15.0%	3	0.6%	0.0%
bandeira complex*	3	20.5%	13.9%	5	0.6%	1.7%
T. caparaoensis sp. nov.	6	4.2%	14.9%	5	7.8%	0.0%
T. cerradoensis sp. nov.	7	8.7%	12.8%	4	0.3%	1.4%
T. cipo Henriques-Oliveira & Dumas, 2015	4	13.1%	15.2%	4	0.3%	6.5%
T. egleri Sattler, 1963	2	1.6%	14.3%	0	—	—
T. flintorum Holzenthal, 1988	3	16.6%	13.9%	1	—	4.8%
T. gracilis (Burmeister, 1839)	7	3.6%	14.1%	6	0.3%	1.7%
T. iguassu sp. nov.	5	6.5%	14.7%	4	0.6%	0.8%
T. itatiaia Dumas & Nessimian, 2010	2	12.8%	13.5%	2	3.1%	3.4%
T. jaffueli Navás, 1918	7	12.3%	16.7%	3	1.2%	4.6%
T. mantiqueira sp. nov.	7	1.3%	14.9%	3	0.3%	0.0%
T. maranhensis	1	—	13.1%	1	—	4.8%
T. neblinus Holzenthal, 1988	0	—	—	2	0.0%	2.9%
T. nevadus Holzenthal, 1988	0	—	—	1	—	2.9%
T. nigripennis Mosely, 1936	3	0.6%	16.6%	2	0.3%	4.6%
T. paragracilis sp. nov.	5	3.4%	8.7%	5	0.6%	0.8%
T. puri sp. nov.	2	0.0%	13.6%	2	0.0%	4.2%
T. qosqo Henriques-Oliveira & Dumas, 2015	1	—	13.1%	1	—	4.8%
T. ultimus Holzenthal, 1988	3	0.9%	12.3%	3	4.4%	1.0%

ASAP analysis split the 135 Triplectides COI sequences into 51 potential species (best score=3.0), 30 of them among the Neotropical lineages analyzed (Fig. 1). bPTP using ML tree of COI recovered 71 species (with the highest posterior probability supported solution), 42 species among Neotropical sequences (Fig. 1). ASAP analysis split the 79 EF-1α sequences of Triplectides analyzed into 27 potential species (best score=1.0), 22 of them within the Neotropical lineages (Fig. 1). bPTP using EF-1α ML tree resulted in 41 potential species (with the highest Bayesian supported solution), 35 of them among the Neotropical lineages (Fig. 1).

Considering the concatenated ML tree, ASAP and bPTP analyses, and morphology, we were able to recognize 19 morphological species among the Neotropical taxa studied, including 7 new species described here. According to our results, T. gracilis, as currently known, includes at least 6 species, in some cases with very subtle morphological variations. The group of species within the Triplectides gracilis group includes: T. bandeira sp. nov., T. cerradoensis sp. nov., T. gracilis, T. iguassu sp. nov., T. mantiqueira sp. nov., and T. paragracilis sp. nov. Except for T. bandeira sp. nov., the other 5 species showed lower maximum COI intraspecific K2P distances (< 9%) than the minimum interspecific distances observed among Triplectides sequences (Table 3). The specimens identified morphologically as Triplectides bandeira sp. nov. (bandeira complex) were recovered as a potential species only by ASAP with EF-1α sequences, being recovered as 3 or 4 distinct species in analyses with COI and bPTP with EF-1α (Fig. 1). ML tree also presents bandeira complex constituted by at least 2 independent lineages. Although we recognized that this species is likely a complex of species, we did not find consistent morphological differences allowing us to describe them separately.

In addition to these, a new species, T. caparaoensis sp. nov., related to T. ultimus also was defined based on morphological data, being also recovered, at least in part, with the distinct molecular tools (Fig. 1). Finally, T. puri sp. nov., a new species morphologically similar to T. misionensis, was also delimited based on male morphology and delimitation results. ML and delimitation analyses allowed molecular associations between larvae and adults for eight species, the Chilean T. jaffueli and seven Brazilian species. Six out of the seven species associated here had no previous information of immature stages, and larval descriptions are provided below. In addition, since we are redefining the limits of T. gracilis, we are also describing the larvae associated here.

3.2. Taxonomy

LEPTOCERIDAE Leach, 1815

Triplectides Kolenati, 1859

3.2.1. Triplectides gracilis (Burmeister, 1839)

Figures 2, 3

Triplectides gracilis (Burmeister, 1839: 921), as Mystacides gracilis (type locality: Brazil; specimen collected by Beske, probably from Nova Friburgo, Rio de Janeiro). Holotype destroyed, depository: ZIUH. Ulmer 1905: 27 (redescription). Mosely 1936: 96 (redescription). Holzenthal 1988: 195 (redescription, neotype designation: Brazil, Rio de Janeiro, 950 m, Nova Friburgo, municipal water supply; depository: MZSP). Sganga et al. 2013: 26 (larva and pupa from Argentina).

Triplectides principes (Burmeister, 1839: 921), as Mystacides principes (type locality: Brazil; specimen collected by Beske, probably from Nova Friburgo, Rio de Janeiro). Holotype destroyed, depository: ZIUH. Ulmer 1905: 27 (to synonymy).

Triplectides ramulorus (Müller, 1921: 241), Tetracentron ramulorum, only larva and pupa (type locality: Brazil, Santa Catarina). Type material and depository not designated. Holzenthal 1988: 195 (to synonymy).

Material examined.

BRAZIL • 1 ♂; Rio de Janeiro, Guapimirim, Parque Nacional da Serra dos Órgãos, Trilha das Ruínas, tributary of Rio Soberbo; 22°29′45.0″S 42°59′46.6″W; alt. 344 m; 25 mar. 2010; L.L. Dumas, J.L. Nessimian leg.; light trap; [DNA voucher ENT0672]; DZRJ TRICHOPTERA9166 • 1 ♂; Rio de Janeiro, Nova Friburgo, Rio Bonito, km 13.5; 01–03 Oct. 2021; light trap; A.P.M. Santos leg. [DNA voucher ENT5922]; DZRJ TRICHOPTERA9167 • 1 larva; Rio de janeiro, Petrópolis, Araras, ROCIO, stream in the road; 22°28′25.5″S 43°15′49.10″W; 08 May 2018; A.L.H. Oliveira, J.L. Nessimian, C. Novais leg.; [DNA voucher ENT4358]; DZRJ TRICHOPTERA9171 • 1 larva; same data as for preceding, except, small stream near to SINDACTA; 22°28′19.2″S 43°17′44.5″W; alt. 1194 m; 08 May 2018; A.L.H. Oliveira, J.L. Nessimian, C. Novais leg.; [DNA voucher ENT4359]; DZRJ TRICHOPTERA9170 • 1 larva; Rio de Janeiro, Petrópolis, Araras, Reserva Biológica de Araras, trilha das águas (poço); 22°26′06″S 43°15′33.1″W; alt. 993 m; 29 Jan. 2020; A.L.H. Oliveira leg.; [DNA voucher ENT5388]; DZRJ TRICHOPTERA9169 • 1 larva; same data as for preceding; [DNA voucher ENT5389]; DZRJ TRICHOPERA9172 • 1 larva; Rio de Janeiro, Teresópolis, Parque Nacional da Serra dos Órgãos, Rio Paquequer (bridge); 22°27′25.05″S 42°59′51.80″W; alt. 1112 m; 21 Aug. 2014; A.L.H. Oliveira leg.; [DNA voucher ENT1998]; DZRJ TRICHOPTERA9168.

Description.

Adult. For a full description of adult of T. gracilis see Holzenthal (1988). Photographs of adult wings are provided in Figure 2. — Larva. Total length 10–17 mm (n = 5) (Fig. 3A). — Head: Coloration (in alcohol) reddish brown to dark brown, with many pale spots on the front and posterior portions, and a pale oval area around the stemmata (Fig. 3B). Head almost sub-rectangular, slightly enlarged posteriorly, in dorsal view (Fig. 3B). Labrum pale brown, in dorsal view, subtrapezoidal with anterolateral corner rounded, three pairs of labral setae in the middle length with brush of short, secondary setae on its anteroventral margin. Mandible dark, asymmetrical, typical for Triplectides (left mandible with 6 teeth around a concavity and right mandible with 5 teeth). Submentum oval. Ventral apotome subtriangular, slender, and narrow (Fig. 3B), slightly wide anteriorly with a small constrict in mid-length, narrowing posteriorly to an acute pointed tip (Fig. 3B). — Thorax: Pro- and mesonotum reddish brown with pale muscle scars and spots (Fig. 3D). Pronotum with anterior and lateral margins crenulate; slightly protruded on the corners, posterior margin rounded (Fig. 3C). Mesonotum covered by a pair of large sclerites: sa1 each with long single seta; sa2 each with 3 setae: (one mesal longer than the others); sa3 each with 6 setae (2 long setae on the corner, and other 4 short). Metanotum covered by 3 pairs of thin and pale brown sclerites: sa1 subquadrate, bearing a long seta each, sa2 subquadrate with a very long seta each, sa3 elongate, oval, bearing 3 setae each (Fig. 3D). Prosternum narrow with a dark subtriangular sclerite. Mesosternum with pair of subtriangular sclerites, curved laterally; anterior margin dark brown (Fig. 3E). Metasternum with setal area bearing 8–10 setae (Fig. 3E). Foretrochantin with anterodorsal margin straight, with corner pointed and upturned and anteroventral corner rounded (Fig. 3C). Legs yellowish brown with dark brown stripes, setose (Fig. 3G). — Abdomen: Gills simple, present on segments II–VIII, segments II–VI with dorsal, lateral, and ventral filaments; segment VII with lateral and ventral filaments; segment VIII with ventral filaments (Fig. 3H). Segments III–VIII with lateral fringes. Segment I with two pairs of long setae at the base of dorsal hump. Segment VIII with a pair of posteromesal setae. Segment IX dorsal sclerite with 6 very long setae on posterior margin and 2 pairs of very short, lateral setae, one anterolateral short seta at each side of the sclerite (Fig. 3F). Anal claws single, large, and pointed, with a small dorsal accessory hook (Fig. 3F). — Larval case: Length up to 16 mm. Simple hollow stick (Fig. 3I).

Figure 2.

Triplectides gracilis (Burmeirster, 1839), male wings (DNA voucher ENT5922). A Forewing; B Hind wing; C Forewing cross veins in detail; D, E Hind wing fork I in detail (E: DNA voucher ENT0672). — Abbreviations: Sc = subcostal vein; R = radial vein; M = median vein; Cu1A = anterior first cubital vein; Cu1P = posterior first cubital vein; Cu2 = second cubital vein; A = anal vein; s = sectorial cross vein, r-m = radial-median cross vein; m-cu = median-cubital cross vein; Dc = discoidal cell; Th = thyridial cell; I, III, V = forks I, III, and V, respectively.

Figure 3.

Tripletides gracilis, larva (DNA voucher ENT4359). A Habitus, lateral view; B Head, dorsal, ventral, and lateral views; C Pronotum and protrochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Right fore-, mid-, and hind legs; H Diagram of distribution of abdominal gills (I–IX = abdominal segments); I. Larval case.

Distribution.

Argentina, Brazil, and Paraguay.

Remarks.

Triplectides gracilis was described by Burmeister (1839) based on a specimen collected by Beske, probably from Nova Friburgo municipality, Rio de Janeiro State, Southeastern Brazil. The male holotype of T. gracilis and the type of Triplectides principes (Burmeister, 1839), a junior synonym from the same locality, were apparently destroyed in World War II (Holzenthal 1988). According to Ulmer (1905), Burmeister (1839), and Kolenati (1859) later, recognized this second species probably due to size differences observed between the specimens. Holzenthal (1988), when revising the Neotropical Triplectides, designated a neotype for T. gracilis from a male also from Nova Friburgo municipality, Rio de Janeiro, Brazil. In the same work, Holzenthal (1988) synonymized the name T. ramulorum, used by Müller (1921) for immatures from Santa Catarina State (Brazil), with T. gracilis. Since the holotypes of T. gracilis and T. principes are destroyed (Holzenthal 1988) and there is no material of T. ramulorum, we do not propose any changes related to these synonyms.

Triplectides gracilis is one of the most widespread species of Triplectides in South America, occurring from Northeastern to Southern Brazil, and extending through Argentina and Paraguay (Holzenthal 1988; Desidério et al. 2020). Due to its wide distribution, sequences of COI from many specimens previously identified as Triplectides gracilis from different localities in Brazil were used to evaluate its identity as a species. Not surprisingly, we found high genetic divergences among the specimens of T. gracilis, with six potential species being detected in our analyses. Based on rigorous reanalysis of male morphology, we were able to identify and describe as new five species within this group: T. bandeira sp. nov., T. cerradoensis sp. nov., T. iguassu sp. nov., T. mantiqueira sp. nov., and T. paragracilis sp. nov. Although these six species (including the redefined T. gracilis) can be recognized by male morphology, they are very similar to each other, therefore previous identification of T. gracilis and distribution data should be viewed with caution. Because of this high morphological similarity, contrasting with high molecular divergences, we describe these new species below within the informal group of species.

A detailed description of T. gracilis was provided by Holzenthal (1988). We analyzed many specimens from Rio de Janeiro, including Nova Friburgo municipality (where the holotype and the neotype were collected). We are retaining the name T. gracilis to those that fit in the description provided by Holzenthal (1988) based on the neotype. Seven species in the T. gracilis complex have very similar male genitalia, but they can be consistently distinguished from each other by some details. Triplectides gracilis is very similar to T. paragracilis sp. nov. and T. iguassu sp. nov. in the general aspect of male genitalia, with segment IX, in dorsal view, subtriangular and protruded over tergum X; preanal appendages slender, digitate, rounded, and setose; tergum X, in dorsal view, almost straight, with apicomesal incision extending beyond half the length of the tergum, bearing short and stout setae on its surface. Triplectides gracilis differs from these two species by the mesal lobe of inferior appendages without a sclerotized tooth on basolateral margin (Fig. 13A). Other important feature is related to wing venation (Fig. 2A, B), where the fork I of hind wing can be sessile with R2 arising anteriorly to R3 (Fig. 2D), corroborating those drawn by Holzenthal (1988) or with R2 and R3 arising together forming a very small petiole (Fig. 2E).

The fisrt larval descriptions for Triplectides gracilis were provided by Müller (1921), as Tetracentron ramulorum, when some general characteristics of the immature forms from Santa Catarina State were given. Sganga et al. (2013) provided a detailed description of T. gracilis immatures from Argentina. However, those specimens may not be part of T. gracilis after the taxonomic delimitation provided here. The larvae associated here from Rio de Janeiro are slightly different from those observed by Sganga et al. (2013) in relation to head and thorax coloration, labrum, form of ventral apotome, edge of pronotum, and thorax sclerites. Triplectides gracilis larvae described here have head almost rectangular with coloration reddish brown to dark brown with several pale spots and labrum brown and subtrapezoidal, while those in Sganga et al. (2013) possessed head coloration homogeneous dark brown, with yellowish oval areas around stemmata, with labrum stramineous, and brown lateral stripes parallel to lateral borders. In the thorax, larvae associated here had pronotum with anterior margin and lateral margin crenulate, and posterior margin rounded; prosternal sclerite subtriangular and metasternum with 8–10 setae, without basal circular sclerite; whereas the larvae from Argentina had pronotum reddish brown; mesal half of anterior edge of each pronotal sclerite with three smooth, rounded crenulations; lateral half plain, slightly produced and rounded; prosternum sclerite rectangular, slightly produced anteriorly and metasternum with 6–9 long setae, with a variable number of basal, circular sclerites (Sganga et al. 2013).

3.2.2. Triplectides bandeira sp. nov.

https://zoobank.org/1745AC79-3ACF-4941-A74B-A8A252ADAE66

Figures 4, 5

Henriques-Oliveira et al. 2020: 46 [as Triplectides neotropicus Holzenthal, 1988]

Type material.

Holotype: BRAZIL • ♂; Espirito Santo, Dores do Rio Preto, Parque Nacional do Caparaó, Rio Preto behind of housing; 20°30′05.80″S 41°49′08.60″W; alt. 1,359 m; 25 Feb. 2012; white sheet; A.L.H. Oliveira leg.; [DNA voucher ENT741]; DZRJ TRICHOPTERA9178 – Paratypes: BRAZIL • 1 ♂; Minas Gerais, Alto Caparaó, Parque Nacional do Caparaó, Vale Verde, 2^nd order tributary of Rio Caparaó; 20°25′08.8″S 41°50′46.6″W; alt. 1,307 m; 07 Oct. 2012; A.P.M. Santos leg.; [DNA voucher ENT706]; DZRJ TRICHOPTERA9177 • 1 ♂; same data as for preceding, except, Rio Caparaó; 20°25′11.60″S 41°50′44.80″W; alt. 1,306 m; 5 Apr. 2016; light trap; J.L. Nessimian, A.L.H. Oliveira, A. Antunes, A.A. Alves, J. Queiroz leg.; [DNA voucher ENT6327]; DZRJ TRICHOPTERA9175.

Description.

Adult male (Holotype). General color golden brown to brown (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax mostly brown, with white and brown bristles. Forewings with forks I and V present; discoidal cell apically large (Fig. 4A, B); cross vein s almost straight, cross vein r-m narrower than m-cu and slightly posterior than that, almost aligned in some individuals (Fig. 4C). Hind wings broad, with forks I, III, and V present; fork I petiolate (Fig. 4D). Length of forewing of holotype 15.69 mm, length of hind wing of holotype 11.00 mm. Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, narrow with anterior margin almost straight, posterior margin slightly concave medially and enlarged dorsally (Fig. 5A); tergum IX, in dorsal view, with posterior margin subtriangular, mesally protruded over the tergum X, dorsal process present and very short (Fig. 5B). Preanal appendages digitate, thin, long, setose, more than half of the tergum X (Fig. 5B). Tergum X, in lateral view, wide basally, almost straight with basal half less sclerotized than apical half, dorsal margin with a small elevation in the mid-length, apex rounded, and slightly upturned (Fig. 5A); in dorsal view, slightly wide basally with apex subtriangular and protrude mesally with a deep apicomesal incision, reaching half the length of the tergum, with a ridge parallel to the lateral margin bearing very short, stout setae (Fig. 5B). Inferior appendages long, surpassing tergum X, bearing very long setae; 1^st article, in lateral view, enlarged at base, constricted medially, with apical portion narrow and rounded (Fig. 5A); apicodorsal lobes digitate, long, extending beyond second article, with very long setae (Fig. 5C); basoventral lobes digitate, longer than mesal lobes, rounded at apex and setose (Fig. 5C); in ventral view, mesal lobes long, in some specimens almost the same length as the phallic apparatus, narrowing towards the apex, rounded and rough, in some individuals giving a club-like appearance, and coloration with a gradient from brown to darker towards the apex (Fig. 5C); 2^nd article long, slender, wide at base, gradually curved inward with acute pointed apex (Fig. 5A, C). Phallic apparatus simple, tubular, with a mesal apical incision, bearing a small mesal projection (Fig. 5D), with phallotremal sclerite small, rod-like, apically positioned (Fig. 5D, E). — Adult female, larva, and pupa unknown.

Figure 4.

Triplectides bandeira sp. nov., male wings (holotype, DNA voucher ENT0741). A Forewing; B Hind wing; C Forewing cross veins, in detail; D Hind wing fork I, in detail. — Abbreviations: see legend Figure 2.

Figure 5.

Triplectides bandeira sp. nov., male genitalia (holotype DNA voucher ENT0741). A Lateral view; B Dorsal view; C Ventral view; D Phallic apparatus, ventral view; E Phallic apparatus, lateral view. — Abbreviations: see text 2.2.

Etymology.

The specific epithet ‘bandeira’ refers to Bandeira Peak, the third highest mountain in Brazil, and it is situated in Serra do Caparaó, on the border between states of Minas Gerais and Espírito Santo Minas Gerais, where the new species was collected.

Distribution.

Brazil (Espírito Santo and Minas Gerais States).

Habitat.

Found inhabiting in Atlantic Forest streams at different altitudes in Serra do Caparaó Mountain range, usually in rocky streams and shady areas.

Remarks.

Molecular results indicate that specimens previously identified as T. bandeira sp. nov. potentially represent a complex of species, with COI K2P divergences reaching 20.5%, higher than any interspecific divergence observed among Triplectides species (Table 3). Only the ASAP analysis with EF-1α sequences indicated the five analyzed sequences of bandeira complex belonged to a single species (Fig. 1). These specimens studied are from different localities, but in the same mountain range, the Serra do Caparaó. Our morphological study allowed to distinguish this species from the others, but it failed to distinguish more than one species within it. Although small variations were observed, for example in the apex of the mesal lobes of the inferior appendages, they were not consistent in the specimens analyzed. Therefore, we recognize this taxon, T. bandeira sp. nov., as being a complex of cryptic species and we hope that new data in the future will help to distinguish them. To avoid any taxonomic problem, the description and illustrations provided here are based exclusively on the male holotype and we are including here only specimens from one lineage (as in Fig. 1) in the definition of this new species.

This species can be confused with T. neotropicus Holzenthal and T. gracilis (Burmeirster). Triplectides neotropicus was described from specimens collected in Cerro de La Neblina, Venezuela. According to Holzenthal (1988), T. neotropicus can be distinguished from its congeners by the mesal lobe of each inferior appendage with apex somewhat capitate and by the very broad apical region of the forewing discoidal cell, and length of forewings varying between 12–14 mm. The new species shows some differences in relation to above-mentioned species. In terms of size, the new species is robust and big, with forewings exceeding 15 mm in length. In the hind wing, T. neotropicus has fork I with a very short petiole, while fork I in the new species has a distinct petiole. Addditional differences are observed in the mesal lobe of the inferior appendages. In the new species, the mesal lobe is long and somewhat sinuous, similar to T. gracilis, narrowing towards the apex. This lobe can be thin and tapering in some individuals, and appear rounded and rough, giving a club-like appearance in others. In contrast, the mesal lobe of T. neotropicus is roughly triangular, broadest apically, narrowest subapically, with a somewhat capitate apex.

3.2.3. Triplectides caparaoensis sp. nov.

https://zoobank.org/1F5C3CBC-88B2-4B58-8F4E-94D68C672A3A

Figures 6, 7, 8, 9

Henriques-Oliveira et al. 2020: 46 [as Triplectides ultimusHolzenthal 1988]

Type material.

Holotype: BRAZIL • ♂; Espirito Santo, Dores do Rio Preto, Pedra Menina, Parque Nacional do Caparaó, Rio São Domingos, Cachoeira da Farofa; 20°28′19.20″S 41°49′41.90″W; alt. 1,897 m; 06 Jan. 2013; light trap; L.L. Dumas, B.H.L. Sampaio, A.L.H. Oliveira, J.L. Nessimian leg.; DZRJ TRICHOPTERA9158 – Paratypes: BRAZIL • 1 larva; same data as for holotype; 27 Mar. 2012; A.L.H. Oliveira leg.; [DNA voucher ENT1987]; DZRJ TRICHOPTERA9162 • 1 ♂; same data as for holotype; 14 Jan. 2014; light trap; A.L.H. Oliveira, G.A. Jardim, J.L. Nessimian, A.L.R. Silva, C. Portela leg.; [DNA voucher ENT2381]; DZRJ TRICHOPTERA9163 • 1 larva; Espirito Santo, Dores do Rio Preto, Parque Nacional do Caparaó, Cachoeira dos Sete Pilões; 20°28′56.80″S 41°49′50.30″W; alt. 1,869 m; 14 Jan. 2014; A.L.H. Oliveira leg.; [DNA voucher ENT3719]; DZRJ TRICHOPTERA9164 • 1 larva; same data as for preceding; 06 Jan. 2013; A.L.H. Oliveira. J.L. Nessimian leg.; [DNA voucher ENT1995]; DZRJ TRICHOPTERA9165 • 1 larva; Espirito Santo, Iúna, Serra do Caparaó, Rio Claro, Cachoeira do Rogério; 20°22′05.5″S 41°49′51.50″W; alt. 1,071 m; 24 Mar. 2012; A.L.H. Oliveira leg.; [DNA voucher ENT1986]; DZRJ TRICHOPTERA9161 • 1 ♂, 1 ♀; Minas Gerais, Alto Caparaó, Parque Nacional do Caparaó, Vale Verde, Rio Caparaó; 20°25′11.6″S 41°50′44.80″W; alt. 1,306 m; 05 Oct. 2010; white sheet; L.L. Dumas, J.L. Nessimian leg.; [DNA voucher ENT5928]; DZRJ TRICHOPTERA9160 • 2 ♂, 1 ♀ same data as for preceding; MNRJ • 1 ♂; same data as for preceding; 07 Oct. 2010; UV light; L.L. Dumas, J.L. Nessimian leg. DZRJ TRICHOPTERA9159 • 1 ♂; same data as preceding; MNRJ. • 2 ♂, 1 ♀; Minas Gerais, Alto Caparaó, Parque Nacional do Caparaó, Vale Encantado, Rio José Pedro; 20°24′38.10″S 41°50′03.60″W; alt. 1,912 m; 05 Oct. 2010; B. Clarkson, I.C. Gonçalves leg.; DZRJ TRICHOPTERA9156 • 1 ♀; same data as for preceding; DZRJ TRICHOPTERA9157.

Description.

Adult male. General color golden brown (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax are mostly brown. Forewings with forks I and V present (Fig. 6A); discoidal cell apically widened; cross vein s sinuous; cross vein r-m slightly shorter than m-cu (Fig. 6C). Hind wings broad, with forks I, III, and V present (Fig. 6B); fork I with petiole (Fig. 6D). Length of forewing 18–22 mm, length of hind wing 15–18 mm (n = 9). Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, narrow, with anterior margin almost straight and enlarged dorsally, posterior margin slightly concave medially (Fig. 7A); in dorsal view, tergum IX with posterior margin subtriangular, slightly protruding mesally, some individuals have a small, rounded median process that is absent in the holotype (Fig. 7A). Preanal appendages digitate, half the length of tergum X, setose, slightly constricted basally, narrowing to the apex, in lateral view oblong. (Fig. 7B). Tergum X, in lateral view, wide basally, saddle-like, with a membranous median region, slightly elevated, tapering apically to a rounded apex (Fig. 7A); in dorsal view, wide basally, bearing very short stout setae, apex slightly widened and subtruncate, with apicomesal incision extending to half length of the segment (Fig. 7B). Inferior appendages, long, extending beyond tergum X, bearing very long setae (Fig. 7A); 1^st article, in lateral view, wide at base, constricted medially, with subapical portion slightly widened, and narrowing towards the apex (Fig. 7A); apicodorsal lobe digitate, elongate, extending beyond 2^nd article, with very long setae (Fig. 7A, C); basoventral lobes digitate, elongate, narrower in the apex, extending beyond 2^nd article, bearing very long setae (Fig. 7A, C); in ventral view, mesal lobe shorter than basoventral lobe, subquadrate, wide at base with apex obliquely truncate, internally acute and externally rounded (Fig. 7C); 2^nd article short, slender, gradually curved mesad to acute apex (Fig. 7A, C). Phallic apparatus simple, tubular, with a mesal apical incision (Fig. 7D) with phallotremal sclerite small, rod-like, apically positioned (Fig. 7D, E). — Adult female. General color golden brown (in alcohol). Antennae, palps, and legs, golden brown. Length of forewing 18–20 mm, length of hind wing 14–16 mm (n = 3). Tibial spur formula 2,2,4. — Genitalia: Sternum VIII, in ventral view, with a sclerotized plate, brown; sternum with anterior margin concave, posterior margin with a shallow V-shaped incision mesally (Fig. 8A). Segment IX sclerotized dorsally, posterior margin subtruncate, with pair of small dorsal processes, fused (Fig. 8B). Preanal appendages small and setose; in lateral view, short, broad at base, subtriangular, truncate, slightly concave apically, where a minute sensilla-bearing process is fused each preanal appendage (Fig. 8B). Lamellae well-developed, sclerotized, flap-like, quadrangular in lateral view (Fig. 8A, B). Gonopod plate subtriangular with apicomesal process striate; spermathecal sclerite elongate, broad, and sclerotized, in ventral view (Fig. 8A). — Larva. Total length 12–18 mm (n = 4) (Fig. 9A). — Head: Coloration (in alcohol) dark brown, with yellow oval areas around stemmata. Muscle scars reddish brown (Fig. 9B). Head subrectangular, enlarged posteriorly (Fig. 9B). Labrum reddish brown, subrectangular with a brush of setae on anterior margin. Mandibles asymmetrical, dark, typical for Triplectides (left mandible with 6 teeth around a concavity and right mandible with 5 teeth). Submentum oval. Ventral apotome subtriangular, elongate, with anterior portion wide with a constriction at mid-length and posterior portion narrowing to an acute tip (Fig. 9B). — Thorax: Pronotum dark brown; anterior margin crenulate: crenulations rounded except for the anterolateral corners slightly pointed (Fig. 9C, D). Mesonotum brown to dark brown almost completely covered by a pair of sclerites: sa1 each with 1 long single seta; sa2 each with 3 setae, anteromesal and anterolateral long and one short posterior setae; sa3 each with 5 setae, a very long on the corner and other 4 shorter). Metanotum covered by 3 pairs of sclerites, sa1 quadrate, bearing each a long single seta, sa2 weakly sclerotized, subquadrate, each with single seta, sa3 sclerites oval, same length or slightly longer than sa1 sclerites, each with 4 setae (2 very long, 1 short, and 1 very short). Prosternum subrectangular. Mesosternum with pair of sclerites subtriangular and curved laterally. Metasternum with setal areas bearing 15–25 setae (Fig. 9E). Foretrochantin with dorsal margin curved, anteroventral corner rounded and anterodorsal corner pointed and upturned (Fig. 9C). Legs dark brown to reddish brown with lighter stripes, and setose (Fig. 9G). — Abdomen: Gills simple, present on segments II–VIII, segments II–VII with dorsal, lateral, and ventral filaments; segment VIII with ventral filaments (Fig. 9H). Segments III–VIII with lateral fringes. Segments II–VII without dorsal setae. Segment VIII with a pair of setae laterally, and a pair of very long setae on posterodorsal margin. Segment IX dorsal sclerite with 6 very long setae on its posterior margin, 2 lateral and 1 mesal, and 2 pairs of very short setae behind those pairs (Fig. 9F); anal claw single and pointed with a small dorsal accessory hook (Fig. 9F). — Larval case: Length up to 14 mm (n = 4). A simple hollow stick or composed by hollow wood stick with attached leaves and smaller sticks with silk near the opening (Fig. 9I). — Pupa unknown.

Figure 6.

Triplectides caparaoensis sp. nov., male wings (paratype). A Forewing; B Hind wing; C Forewing cross veins, in detail; D Hind wing fork I, in detail. — Abbreviations: see legend Figure 2.

Figure 7.

Triplectides caparaoensis sp. nov., male genitalia (holotype). A Lateral view; B Dorsal view; C Ventral view; D Phallic apparatus, ventral view; E Phallic apparatus, lateral view.

Figure 8.

Triplectides caparaoensis sp. nov., female genitalia (paratype). A Ventral view; B Lateral view. — Abbreviations: see text 2.2.

Figure 9.

Triplectides caparaoensis sp. nov., larva (DNA voucher ENT1995). A Habitus, dorsal view; B Head, dorsal, ventral, and lateral views; C Pronotum and trochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Right fore-, mid-, and hind legs; H Diagram of distribution of abdominal gills (I–IX = abdominal segments); I. Larval case.

Etymology.

The epithet caparaoensis refers to Serra do Caparaó Mountain range, where specimens of this new species were collected.

Distribution.

Brazil (Espiríto Santo and Minas Gerais States).

Habitat.

This species was found in Atlantic Forest streams with crystalline waters, larger than third order, with waterfalls, sunny, and large deposits of leaf litter. So far, this species is only known from Serra do Caparaó mountain range.

Remarks.

The male of Triplectides caparaoensis sp. nov. is similar to that of T. ultimus Holzenthal, 1988 and T. nessimiani Desiderio and Pes, 2020 by having a short mesal lobe on the inferior appendage. However, in T. caparaoensis sp. nov. the mesal lobe is subquadrate with apex obliquely truncate with the internal margin slightly acute at the corner and the external margin rounded (Fig. 7A), whereas in T. ultimus the external margin is subquadrate and slightly concave in anterior margin, and in T. nessimiani the mesal lobe has an acute lateral projection and 5–7 stout ventral setae basally. Furthermore, the new species can be easily distinguished by tergum X slightly widened apically with subtruncate apex, and apicomesal excision extending anteriorly near half-length of the segment (Fig. 7B), while in T. ultimus tergum X has rounded apex and in T. nessimiani the tergum X is short and obliquely truncate at apex. The new species is also recognized by the preanal appendages which are digitate and oblong (Fig. 7C), being digitate and slender with pointed apex in T. ultimus and digitate with a rounded apex in T. nessimiani.

3.2.4. Triplectides cerradoensis sp. nov.

https://zoobank.org/C4739EB8-7AE2-4484-895E-60C98A613435

Figures 10, 11

Henriques-Oliveira et al. 2019: 46 [as Triplectides gracilis (Burmeister 1839) or as T. neotropicusHolzenthal 1988]

Type material.

Holotype: BRAZIL • ♂; Minas Gerais, São João Batista do Glória, Parque Nacional da Serra da Canastra, Ribeirão Grande, Pousada Mata do Engenho; 20°30′19.79″S 46°31′19.4″W; alt. 747 m; 24 Mar. 2015; light trap; J.L. Nessimian, I.C. Rocha, L.L. Dumas, A.L.H. Oliveira, S.P. Gomes leg.; [DNA voucher ENT3216]; DZRJ TRICHOPTERA9192. – Paratypes: BRAZIL • 1 ♂; Minas Gerais, São Roque de Minas, Parque Nacional da Serra da Canastra, Cachoeira do Jota, Rio Araguari; 20°08′50.00″S 46°40′12.00″W; alt. 1,141 m; 16 Sep. 2015; J.L. Nessimian, A.L.H. Oliveira, I.C. Rocha, P.M. Souto leg.; [DNA voucher ENT2317]; DZRJ TRICHOPTERA9196 • 1 ♂; Minas Gerais, Catas Altas, RPPN Santuário do Caraça, trail of the Lobo-Guará; 20°06′03.3″S 43°29′10.1″W; alt. 1,240 m; 13 Mar. 2015; D.M. Takiya, B.M. Camisão, C.C. Gonçalves leg.; [DNA voucher ENT3725]; DZRJ TRICHOPTERA9195 • 1 ♂; Minas Gerais, Itabira, Ipoema, Parque Estadual Mata do Limoeiro, road to Comunidade do Cedro, Córrego Taquaruçu; 19°34′48.6″S 43°28′28.7″W; alt. 715 m; 15 Dec. 2019; light trap; A.P.M. Santos, A.A. Alves, A.L.H. Oliveira, B.M.S. Cavalcante leg.; [DNA voucher ENT5345]; DZRJ TRICHOPTERA9194 • 1 ♂; Minas Gerais, Itabirito, Vale do Catana, Cachoeira da Carranca 20°12′28.30″S 43°38′26″W; 10 Oct. 2010; light trap; B. Clarkson, I.C. Gonçalves, J.L. Nessimian, L.L. Dumas, N. Ferreira-Jr leg.; [DNA voucher ENT3727]; DZRJ TRICHOPTERA9193 • 1 ♂; São Paulo, São José do Barreiro, Parque Nacional da Serra da Bocaina, 2^nd order stream near the park entrance; 22°43′49.6″S 44°37′7.6″W; 20 Oct. 2013; light trap; P.M. Souto leg.; [DNA voucher ENT2308]; DZRJ TRICHOPTERA9197.

Description.

Adult male. General color golden brown (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax mostly golden brown. Forewings with forks I and V present (Fig. 10A); discoidal cell long and apically widened; tyridial cell almost twice the length of discoidal cell (Fig. 10A); cross vein s straight and short, r-m and m-cu almost the same width and aligned (Fig. 10C). Hind wings broad, with forks I, III, and V present (Fig. 10B); fork I with a distinct petiole (Fig. 10D). Length of forewing 13–15 mm, length of hind wing 9.5–11.5 mm (n = 6). Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, narrow with anterior margin almost straight, posterior margin slightly convex medially and enlarged dorsally, produced over tergum X (Fig. 11A); tergum IX, in dorsal view, with posterior margin triangular, mesally protruded over the tergum X (Fig. 11B); some individuals have a median process with a very small incision apically, that is absent in the holotype. Preanal appendages digitate, thin, slightly longer than half the length of tergum X, bearing very long setae (Fig. 11A). Tergum X, in lateral view, with anterior area elevated with basal half less sclerotized than apical half, apex rounded and slightly upturned (Fig. 11A); in dorsal view, almost straight, with apex subtriangular and rounded, V-shaped apicomesal incision longer than half the length of the tergum X (Fig. 11A, B). Inferior appendages, long, extending beyond tergum X, bearing very long setae; 1^st article, in lateral view, wide at base, constricted medially, with apical portion narrow and rounded apically (Fig. 11A); apicodorsal lobe digitate, long, extending beyond second article, with very long setae (Fig. 11A); basoventral lobes digitate, rounded and bearing long setae (Fig. 11A); in ventral view, mesal lobes extending beyond insertion of the 2^nd article, broad at the base, sinuate with rounded and blunt apex, mesal lobe coloration with a brown to dark brown gradient towards apex, and in some individuals the apex may have a slightly rough texture (Fig. 11C); 2^nd article elongate, slender, wider at base, gradually curved mesad, and acute apically (Fig. 11C). Phallic apparatus simple, tubular, with a mesal apical U-shaped incision, in ventral view (Fig. 11D), with phallotremal sclerite small, rod-like, apically positioned (Fig. 11D, E). — Adult female, larva, and pupa unknown.

Figure 10.

Triplectides cerradoensis sp. nov., male wings (DNA voucher ENT2308). A Forewing; B Hind wing; C Forewing cross veins, in detail; D Hind wing fork I, in detail. — Abbreviations: see legend Figure 2.

Figure 11.

Triplectides cerradoensis sp. nov., male genitalia (holotype). A Lateral view; B Dorsal view; C Ventral view; D Phallic apparatus, ventral view; E. Phallic apparatus, lateral view.

Etymology.

The specific epithet ‘cerradoensis’ refers to the Cerrado biome, the second largest vegetational biome in Brazil. The Cerrado, also known as ‘Brazilian savannah,’ extends over 1.5 million km² in the central Brazil and covers 11 states and the Federal District.

Distribution.

Brazil (Minas Gerais and São Paulo States).

Habitat.

Specimens were collected in creeks of different orders and distinct physical characteristics, from stony to sandy bottoms in open areas with scarce marginal vegetation and with high luminosity.

Remarks.

In T. cerradoensis sp. nov. the inferior appendages, is characterized by a long mesal lobe that is broad at the base, sinuate, and terminating in a rounded and blunt apex (Fig. 11A), with a brown coloration gradually darkening toward the apex, represent a key diagnostic feature distinguishing this species from its congeners. Although this structure is somewhat similar to that of T. flintorum, the new species can be readily separated by the morphology of tergum X. In dorsal view, tergum X is nearly straight, with a subtriangular, rounded apex and a distinct V-shaped apicomesal incision extending to mid-length (Fig. 11B). In contrast, T. flintorum exhibits a straight, truncate apex on tergum X, with only a short apicomesal incision. Additional distinguishing characteristics include the configuration of the forewing crossveins: in the new species, crossvein s is short and straight, while crossveins r-m and m-cu are of nearly equal width and aligned (Fig. 10A). In T. flintorum, crossvein s is longer, also straight, and either directly contacting r-m or slightly distal to it, as observed by Holzenthal (1988). Intraspecific K2P divergences of COI sequences were relatively high for this species (8.7%) (Table 3). The ASAP results for both COI and EF-1α sequences supported this new species (Fig. 1). Conversely, the bPTP analyses indicated more potential species within this taxon (Fig. 1).

3.2.5. Triplectides iguassu sp. nov.

https://zoobank.org/0ABC6743-43A7-4987-BED1-3B895F1492B8

Figures 12, 13, 14, 15

Type material.

Holotype: BRAZIL• ♂; Paraná, Céu Azul, Parque Nacional do Iguaçu, Rio Manoel Gomes; 25°09′39.4″S 53°49′45.9″W; alt. 498 m; 06 Sep. 2012; light; A.P.M. Santos, D.M. Takiya, A.L.H. Oliveira, B. Clarkson leg.; DZRJ TRICHOPTERA9198. – Paratypes: BRAZIL • 10 ♂; same data as for holotype; DZRJ TRICHOPTERA6301 • 8 ♀; same data as for holotype; light trap; A.L.H. Oliveira, B. Clarkson leg.; DZRJ TRICHOPTERA6300 • 1♂; same data as for preceding; [DNA voucher ENT2001]; DZRJ TRCHOPTERA9200 • 4 ♂, 2 ♀; same data as for preceding; MNRJ • 1♂; same data as for holotype; white sheet; A.P.M. Santos, D.M. Takiya, A.L.H. Oliveira, B. Clarkson leg.; DZRJ TRICHOPTERA9199 • 1♂; same data as for preceding; [DNA voucher ENT2385]; DZRJ TRCHOPTERA9201 • 6 ♂; same data as for preceding; 07 Sep. 2012; white sheet; G.A. Jardim leg.; DZRJ TRICHOPTERA7059 • 1 larva; same data as for preceding; hand net; APM Santos, DM Takiya leg.; DZRJ TRICHOPTERA9209 • 1 larva; Paraná, Céu Azul, Parque Nacional do Iguaçu, Rio Azul; 25°09′20.90″ S 53°47′44,40″ W; alt. 510 m; 06 Sep. 2012; A.L.H. Oliveira leg.; [DNA voucher ENT1999]; DZRJ TRICHOPTERA9202 • 1♂; Rio Grande do Sul, Cambará do Sul, Parque Nacional Aparados da Serra, Arroio Preá; 24°09′48.66″ S 50°05′11.00″W; 08–10 Feb. 2014; Malaise trap; A.P. Pinto, J.G. da Silva leg.; [DNA voucher ENT3724]; DZRJ TRICHOPTERA9204 • 1♂; Santa Catarina, Blumenau, Parque Ecológico Spitzkopf, Ribeirão do Caeté, abaixo da Cascata Ferdinando; 27°00′23.10″ S 49°06′57.30″ W; alt. 139 m; 19–22 Jan 2011; A.P.M. Santos, D.M. Takiya, J.L. Nessimian, R.B. Braga leg.; [DNA voucher ENT2306]; DZRJ TRICHOPTERA9203.

Description.

Adult male. General color brown (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax mostly brown. Forewings with forks I and V present; discoidal cell apically widened (Fig. 12A); cross vein s inflected medially, cross vein r-m and m-cu short and aligned (Fig. 12C). Hind wings broad, with forks I, III, and V present (Fig. 12B); fork I with a short petiole (Fig. 12D). Length of forewing 13.5–14.5 mm, length of hind wing 9.5–10.5 mm (n = 20). Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, narrow with anterior margin almost straight and enlarged dorsally, posterior margin slightly concave medially (Fig. 13A); tergum IX with posterior margin almost rounded with external margin protruded, median process short and bifid (Fig. 13A, B). Preanal appendages digitate, slightly oblong, approximately half the length of tergum X, bearing very long setae (Fig. 13A). Tergum X, in lateral view, wide at base, basal half less sclerotized than apical half, tapering apically, with apex rounded and slightly upturned (Fig. 13A); in dorsal view, slightly wide at base with apex truncate and rounded, V-shaped apicomesal incision extending anteriorly less than half the length of the segment, with lateral line of very short and stout setae near the lateral margin (Fig. 13B). Inferior appendages, long, extending beyond tergum X, bearing very long setae; 1^st article, in lateral view, wide at base, constricted medially, with apical portion narrow and rounded apically (Fig. 13A); apicodorsal lobe digitate, long, extending beyond 2^nd article, with very long setae (Fig. 13A); basoventral lobes digitate, rounded and bearing long setae (Fig. 13A, C); in ventral view, mesal lobes long, almost as long as basoventral lobes, sinuate, rounded apically, with a tooth-like projection basally on lateral margin (Fig. 13C); 2^nd article long, slender, wide at base, gradually curved mesad to an acute apex (Fig. 13C). Phallic apparatus simple, tubular, with a mesal apical, U-shaped incision, with a small mesal projection (Fig. 13D), with phallotremal sclerite small, rod-like, apically positioned (Fig. 13D, E). — Adult female. General color brown (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax are mostly brown. Length of forewing 13–14.5 mm, length of hind wing 9.5–10.5 mm (n = 10). Tibial spur formula 2,2,4. — Genitalia: Sternum VIII, in ventral view, with a large sclerotized plate, brown; anterior margin straight, posterior margin with short mesal incision (Fig. 14A). Segment IX sclerotized dorsally, posterior margin subtruncate, and slightly rounded. Preanal appendages, digitate, slender, and setose, in lateral view (Fig. 14B). Sensilla-bearing process minute can be present below the lamella. Lamellae subquadrate, flap-like, internally concave (Fig. 14B). Gonopod plate large, membranous, with apicomesal process subquadrate and striate in ventral view. Spermathecal sclerite slingshot-shaped and short (Fig. 14A). — Larva. Length up to 12 mm (n = 1) (Fig. 15A). — Head: Coloration (in alcohol) dark brown, with pale oval area around stemmata. Muscle scars, in general, with the same color as the head, with the exception of the posterior portion with somewhat pale scars (Fig. 15B). Head oval with labrum stramineous, sub rectangular with 3 long setae at half the length of the labrum. Mandibles asymmetrical, dark, typical for Triplectides, left mandible with 6 teeth around a concavity and right mandible with 5 teeth. Submentum oval. Ventral apotome subtriangular, elongate, with a constriction at mid-length and narrowing to an acute tip (Fig. 15B). — Thorax: Pronotum dark brown; anterior margin with smooth crenulations, lateral portion slightly protruded with corners pointed (Fig. 15C, D). Mesonotum brown almost completely covered by a pair of large sclerites: sa1 each with single long seta; sa2 each with 3 setae: (one mesal long, anterolateral and posterior short), sa3 each with 6 setae (2 long and 4 short). Metanotum covered by 3 pairs of sclerites: sa1 quadrate, bearing each a long single seta, sa2 pale, weakly sclerotized, subquadrate, each with single seta, sa3 sclerites elongate, oval, each with 3 setae (2 very long, 1 short) (Fig. 15D). Prosternum rectangular. Mesosternum with a pair of sclerites subtriangular curved laterally. Metasternum with a setal area bearing 8 setae (Fig. 15E). Foretrochantin with antero-dorsal margin curved, pointed, and upturned; anteroventral margin rounded (Fig. 15C). Legs yellowish brown with brown striped region in the pro- and meso-coxa (Fig. 15G). — Abdomen: Gills simple, present on segments II–VIII; segments II–VII with dorsal, lateral, and ventral filaments; segment VIII with dorsal and lateral filaments (Fig. 15H). Segment I with a pair of long anteromesal setae; segments II–VII with a pair of posteromesal setae, without dorsal setae. Segment VIII with a pair of antero-lateral setae, and a pair of long posteromesal setae. Segment IX dorsal sclerite with 6 long setae on its posterior margin, and 2 pairs of very short setae behind those (Fig. 15G). Anal claw single, large and pointed, with a small dorsal accessory hook (Fig. 15F). — Larval case: Length up to 20 mm. A simple hollow wood or small sticks (Fig. 15I). — Pupa unknown.

Figure 12.

Triplectides iguassu sp. nov., male wings (holotype). A Forewing; B Hind wing; C Forewing cross veins, in detail of forewing; D Hind wing fork I. — Abbreviations: see legend Figure 2.

Figure 13.

Triplectides iguassu sp. nov., male genitalia (holotype). ALateral view; B Dorsal view; C Ventral view (detail of tooth-like projection at base of mesal lobe of inferior appendage); D Phallic apparatus, ventral view; E Phallic apparatus, lateral view.

Figure 14.

Triplectides iguassu sp. nov., female genitalia (paratype). A Ventral view; B Lateral view.

Figure 15.

Triplectides iguassu sp. nov., larva (DNA voucher ENT1999). A Habitus, dorsal view; B Head, dorsal, ventral, and lateral views; C Pronotum and trochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Left fore-, mid-, and hind legs; H diagram of distribution of abdominal gills (I–IX = abdominal segments); I. Larval case.

Etymology.

The epithet ‘iguassu’ refers to the Iguaçu National Park, where the holotype was collected. The name “Iguaçu” originates from the Guarani language, in which “I” or “y” means “water” and “guassu” means big, referring to the grandeur of the river and the Iguaçu Falls (Cataratas do Iguaçu), which have the highest water flow of any waterfall in the world.

Distribution.

Brazil (Paraná, Rio Grande do Sul, and Santa Catarina States).

Habitat.

Specimens were found in several types of forested streams in the Atlantic Forest.

Remarks.

Triplectides iguassu sp. nov., T. gracilis Burmeirster, 1839, and T. paragracilis sp. nov. have very similar male genitalia aspect. Often in entomological collections, many specimens identified as T. gracilis likely includes a mix of these three species. The most conspicuous feature to distinguish T. iguassu sp. nov. from T. gracilis based on male genitalia is the presence of a tooth-like projection at the base of the mesal lobe of the inferior appendages. This tooth is present and robust in the new species and completely absent in T. gracilis, including the specimen illustrated and described by Holzenthal (1988) and several specimens of T. gracilis examined here. Triplectipes paragracilis sp. nov., described below, also has a small projection at the lateral base of the mesal lobe of the inferior appendages (Fig. 20A), but in T. iguassu sp. nov. the spine-like projection is much more pronounced (Fig. 13A). Also, those two species can be recognized by the tergum IX, in T. iguassu sp. nov. only slightly concave in dorsal view (Fig. 13B), and in T. paragracilis sp. nov. with posterior margin emarginate and slightly produced over tergum X (Fig. 20B). Although those three species are very similar based on male genitalia, potentially being confused based on morphology, DNA sequences consistently distinguish them as distinct species (Fig. 1). ASAP and bPTP using EF-1α sequences indicated T. iguassu sp. nov. and T. paragracilis sp. nov. as being only one species, but COI sequences indicated otherwise. In fact, K2P divergences of COI from those three species are very high. The higher intraspecific K2P divergences of COI observed within T. iguassu sp. nov. sequences were 6.5% (Table 3). On the other hand, minimum divergences K2P divergences of COI observed among T. iguassu sp. nov. and T. paragracilis sp. nov. were higher than 15.6%, and among T. iguassu sp. nov. and T. gracilis higher than 17.3%.

The larvae of this new species can be identified by head and body sclerites dark brown with labrum, antenna, and legs stramineous. Head oval, in dorsal and lateral view, ventral apotome subtriangular, elongate, with a constriction at mid-length and narrowing to an acute tip. Pronotum with anterior margin with smooth crenulations, and lateral portion slightly protruded with corners pointed; metanotum covered by 3 pairs of sclerites and metasternum with a setal area bearing 8 setae. Other important features to identify this species are foretrochantin with antero-dorsal margin curved, pointed, and upturned and anteroventral margin rounded and abdominal gills present on segments II–VIII (segments II–VII with dorsal, lateral, and ventral filaments, and segment VIII with dorsal and lateral filaments).

3.2.6. Triplectides mantiqueira sp. nov.

https://zoobank.org/AB8CFC85-45DB-4B03-AEEB-1FA23FFDF8EB

Figures 16, 17, 18

Type material.

Holotype: BRAZIL • ♂; São Paulo, Campos de Jordão, Parque Estadual de Campos de Jordão, Rio Cosquilho; 21 Oct. 2006; light trap; M.R. Spies leg.; [DNA Voucher ENT2313]; DZRJ TRICHOPTERA9218. – Paratypes: BRAZIL • 1 ♂; Minas Gerais, Itamonte, Vale do Aiuruoca, Rio Aiuruoca; alt. 1,860 m; 25 Nov. 2010; D.M. Takiya leg.; [DNA voucher ENT2384]; DZRJ TRICHOPTERA2922 • 1 ♂; Minas Gerais, Bocaina de Minas, Córrego do Morro Cavado, Cachoeira Santa Clara; 22°18′53.70″S 44°35′45.20″W; 27 Jan. 2012; light trap; B.H. Sampaio, A.L.H. Oliveira leg.; [DNA voucher ENT2383]; DZRJ TRICHOPTERA9221 • 1 larva; same data as for preceding; hand net; A.L.H. Oliveira leg.; [DNA voucher ENT2000]; DZRJ TRICHOPTERA9220 • 1 larva; Minas Gerais, Itamonte, 2^nd stream after Fazenda Cabeceira do Aiuruoca; 13 Oct. 2001; J.L. Nessimian leg.; [DNA voucher ENT2315]; DZRJ TRICHOPTERA9223 • 1 ♂; São Paulo, São José do Barreiro, Lajeado, Córrego da Floresta, Cachoeira do Paredão; 22°43′33.30″S 44°37′17.60″W; alt. 1,540 m, 01 Nov. 2012; P.M. Souto leg [DNA voucher ENT3722]; DZRJ TRICHOPTERA9219.

Description.

Adult male. General color brown (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax mostly golden brown with white setae. Forewings with forks I and V present (Fig. 16A); fork I with a long petiole (Fig. 16A); discoidal cell long and apically widened (Fig. 16A); tyridial cell 1.5x longer than discoidal cell, discoidal cell narrowing to the apex (Fig. 16A); cross vein s almost straight, r-m and m-cu very short and almost aligned (Fig. 16A). Hind wings broad, with forks I, III, and V present (Fig. 16B); fork I sessile or with a short petiole (Fig. 16D). Length of forewing 15–16 mm, length of hind wing 11–12 mm (n = 4). Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, short with anterior margin almost straight, posterior margin slightly concave medially (Fig. 17A); tergum IX, in dorsal view, with posterior margin trapezoidal, truncated, medially with internal process protruded (Fig. 17B). Preanal appendages digitate, thin, as longer as half the length of tergum X, bearing very long setae (Fig. 17B). Tergum X, in lateral view, tall in anterior area with basal half less sclerotized than apical half, tapering apically to a rounded apex, slightly upturned (Fig. 17A); in dorsal view, almost straight, apex rounded, V-shaped apicomesal incision extending beyond half the length of the segment, bearing a longitudinal ridge sublaterally from the middle of the tergum to the apex (Fig. 17A, B). Inferior appendages, long, extending beyond the tergum X, bearing very long setae (Fig. 17A, C); 1^st article, in lateral view, wide at base, constricted medially, with apical portion narrow and rounded (Fig. 17A); apicodorsal lobe digitate, long, extending beyond 2^nd article, with very long setae (Fig. 17A); basoventral lobes digitate, rounded apically and bearing very long setae (Fig. 17A); in ventral view, mesal lobes longer than insertion of 2^nd article, broad at the base, sinuate with rounded apex, obliquely directed (Fig. 17C), color of the mesal lobe gradient from brown to dark brown towards the apex; 2^nd article slender, wide at base, gradually curved inwards to an acute apex (Fig. 17C). Phallic apparatus simple, tubular, with a mesal apical U-shaped incision, with a mesal projection (Fig. 17D), with phallotremal sclerite small, rod-like, apically positioned, in ventral view (Fig. 17D), and oval in lateral view (Fig. 17E). — Larva. Length up to 20 mm (n = 2) (Fig. 18A). — Head: Coloration (in alcohol) brown to yellowish brown, with pale oval area around stemmata (Fig. 18B). Head almost rectangular slightly enlarged in posterior region (Fig. 18B). Many muscles scars pale to pale brown at front and at posterior portion of the head (Fig. 18B). Labrum pale brown, subtrapezoidal with three pairs of long setae near the posterior margin. Mandible dark, asymmetrical, typical for Triplectides. Submentum elongate, oval. Ventral apotome subtriangular, anterior portion slightly wide with a slight constriction at mid-length, narrowing posteriorly to acute tip (Fig. 18B). — Thorax: Pronotum and mesonotum brown (Fig. 18D). Pronotum with pale muscle scars; anterior margin crenulate, lateral margin slightly produced and crenulate (Fig. 18C, D). Mesonotum pale, almost covered by a pair of large sclerites: sa1 each with long single seta; sa2 each with 3 setae: (1 mesal and 1 lateromesal long seta, and 1 posterior short); sa3 each with 5–6 setae (2 long setae and the others short). Metanotum covered by 3 pairs of sclerites: sa1 pair, subquadrate, bearing each a long seta, sa2 pair subquadrate, weakly sclerotized, with a pair of long setae, sa3 sclerites elongate, oval, bearing each with 4–6 setae. Prosternum trapezoidal; mesostenum with a pair of subrectangular sclerites, curved laterally; metasternum with a setal area bearing around 15 setae (Fig. 18E). Foretrochantin with anterodorsal corner pointed and upturned and anteroventral corner rounded (Fig. 18C). Legs yellowish brown, and setose (Fig. 18G). — Abdomen: Gills simple, present on segments II–VIII; segments II–VI with dorsal, lateral, and ventral filaments; segment VII with lateral and ventral filaments; segment VIII with ventral filaments (Fig. 18H). Segments III–VIII with lateral fringes. Segment I with 2 pairs of long setae at the base of the dorsal hump. Segment VIII with a pair of posteromesal setae. Segment IX dorsal sclerite with 6 long setae on posterior margin and 2 pairs of very short, lateral setae behind those, and an anterolateral short seta at each side of the sclerite (Fig. 18F). Anal claw single, large and pointed, with a very small dorsal accessory hook (Fig. 18F). — Larval case: Length up to 25 mm. A hollow stick or empty cases of Marilia sp. (Odontoceridae) (Fig. 18I). — Adult female and pupa unknown.

Figure 16.

Triplectides mantiqueira sp. nov., male wings (DNA voucher ENT2384). A Forewing; B Hind wing; C Forewing cross veins, in detail; D Hind wing fork I, in detail. — Abbreviations: see legend Figure 2.

Figure 17.

Triplectides mantiqueira sp. nov., male genitalia (holotype). A Lateral view; B Dorsal view; C Ventral view; D Phallic apparatus, ventral view; E Phallic apparatus, lateral view.

Figure 18.

Triplectides mantiqueira sp. nov., larva (DNA voucher ENT2315). A Habitus, dorsal view; B Head, dorsal, ventral, and lateral views; C Pronotum and trochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Left fore-, mid-, and hind legs; H Diagram of distribution of abdominal gills (I–IX = abdominal segments); I Larval case.

Etymology.

The specific epithet ‘mantiqueira’ refers to the Serra da Mantiqueira, a mountain range that stretches across three Brazilian states: São Paulo, Minas Gerais, and Rio de Janeiro. ‘Mantiqueira’ from the Tupi-guarani language, meaning “rain drop” – through the junction of the terms ‘amana’ (rain) and ‘tykyra’ (drop). The name gives an idea of the great importance of the mountain range as a source of drinking water, forming rivers that supply many cities of southeastern Brazil.

Distribution.

Brazil (Minas Gerais, Rio de Janeiro, and São Paulo states).

Habitat.

Specimens are observed in creeks with stony bottoms, with crystalline fast-flowing waters, in areas of montane Atlantic Forest, above 1,000 m of elevation.

Remarks.

The male of Triplectides mantiqueira sp. nov. can be confused with T. flintorum, T. gracilis, and T. neotropicus by having the slightly sinuate mesal lobe of the inferior appendages (Fig. 17A). However, in the new species, the mesal lobe has a more rounded apex, which is obliquely directed (Fig. 17A). Another feature that helps distinguish this new species is the posterior margin of segment IX in dorsal view being truncate and almost straight (Fig. 17B), while in T. gracilis and T. neotropicus it is triangular in dorsal view and projected dorsally over tergum X in lateral view (Holzenthal 1988). Furthermore, the new species can be easily distinguished from the others by its straight, apically subtruncate tergum X with the apicomesal incision extending at half-length of the segment, in dorsal view (Fig. 17B), while in T. gracilis the tergum X has the internal margin of the apex slightly pointed, in T. neotropicus the apex is rounded, and in T. flintorum is rounded with the mesal incision short. All of our molecular analyses supported this new species, except the EF-1α based bPTP analysis. (Fig. 1). Intraspecific K2P divergences of COI sequences were relatively low, reaching only 1.3%, whereas the lowest interspecific divergence was 14.9% (Table 3).

In general, larvae of T. mantiqueira sp. nov. can be identified by head and body sclerites brown to pale brown with labrum, antenna, and legs pale (Fig. 18A). The main characters to distinguishing larval individuals of this species are the rectangular head slightly enlarged posteriorly; ventral apotome subtriangular with anterior portion slightly wide with a slight constriction at mid-length, narrowing posteriorly to acute tip; pronotum with muscle scars pale, anterior margin crenulate, and lateral margin slightly produced and crenulate; metanotum covered by 3 pairs of sclerites being sa2 weakly sclerotized; metasternum with setal area bearing around 15 setae; foretrochantin with anterodorsal corner pointed and upturned and anteroventral corner rounded; and abdominal gills (Fig. 18H) present on segments II–VIII (segments II–VI with dorsal, lateral, and ventral filaments, segment VII with lateral and ventral filaments, and segment VIII with ventral filaments).

3.2.7. Triplectides paragracilis sp. nov.

https://zoobank.org/06FC5860-42CB-4AF0-A905-37A093906216

Figures 19, 20, 21

Type material.

Holotype: BRAZIL • ♂; Rio de Janeiro, Barra do Piraí, Ipiabas, Fazenda Floresta, tributary of Rio das Flores; 22°20′43.60″S 43°51′30.90″W; alt. 692 m; 10 Apr. 2018; L.L. Dumas, J.L. Nessimian, J.F. Barbosa, A.L.H. Oliveira leg.; [DNA voucher ENT4360]; DZRJ TRICHOPTERA9226. – Paratypes: BRAZIL • 1 ♂; Rio de Janeiro, Guapimirim, Parque Nacional da Serra dos Órgãos, trilha das Ruinas, tributary of Rio Soberbo; 22°29′45.0″S 42°59′46.6″W; alt. 344 m; 25 Mar. 2010; L.L. Dumas, J.L. Nessimian leg.; [DNA voucher ENT2900]; DZRJ TRICHOPTERA9228 • 1 ♂; Rio de Janeiro, Nova Friburgo, Rio Bonito, km 13.5; 01–03 Nov. 2021; light; A.P.M. Santos leg.; [DNA voucher ENT5919]; DZRJ TRICHOPTERA9224 • 1 ♀; same data as for preceding; [DNA voucher ENT5920]; DZRJ TRICHOPTERA9225 • 1 ♂; Rio de Janeiro, Parque Nacional da Tijuca, Rio Archer, gruta Paulo e Virginia; 22°57′15.5″S 43°17′29.9″W; 11 Apr. 2014; J.L. Nessimian, L.L. Dumas, C.C. Gonçalves leg.; light trap; [DNA voucher ENT3219]; DZRJ TRICHOPTERA9227).

Description.

Adult male. General color golden brown with spots of white setae (in alcohol). Antennae, palps, and legs, golden brown. Head and thorax mostly golden brown with dark setae. Forewings with forks I and V present in males; discoidal cell apically large (Fig. 19A); cross vein s sinuate, cross vein r-m and m-cu almost the same width, or cross vein r-m narrow in some individuals, r-m slightly anterior to m-cu (Fig. 19C). Hind wings broad, with forks I, III, and V present (Fig. 19B); fork I with distinct petiole (Fig. 19D). Length of forewing 13.5 ± 0.5 mm, length of hind wing 10 ± 0.5 mm (n = 4). Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, narrow with anterior margin almost straight and enlarged dorsally, posterior margin slightly concave medially (Fig. 20A); tergum IX, in dorsal view, subtrapezoidal with posterior margin rounded, protruded, and thickened; median process short and rounded (Fig. 20B). Preanal appendages digitate, less than half length of tergum X, narrower at base and slightly narrower at apex, bearing long dark or golden setae; in lateral view slightly oblong (Fig. 20A, B). Tergum X, in lateral view, wide at base, basal half less sclerotized than apical half, tapering apically, with apex rounded (Fig. 20A); in dorsal view, almost straight, with apex narrow and rounded, V-shaped apicomesal incision short, extending to half length of the segment, bearing a dorsal line with stout setae near the external margin (Fig. 20C). Inferior appendages, long, surpassing tergum X, bearing long setae; 1^st article, in lateral view, wide at base, constricted medially, with apical portion narrow and rounded; apicodorsal lobe digitate, long, extending beyond 2^nd article, with long setae; basoventral lobes digitate, rounded and bearing long setae (Fig. 20A); in ventral view, mesal lobes long, almost the same length as basoventral lobes, sinuate, with apex narrow and rounded, with a small tooth-like projection (which may or may not bear setae) at base of outer margin (Fig. 20C); 2^nd article slender, wide at base, gradually curved inward with acute pointed apex subapically (Fig. 20C). Phallic apparatus simple, tubular, with phallotremal sclerite small, rod-like, apically positioned (Fig. 20D, E). — Adult female. General color golden brown (in alcohol). Antennae, palps, and legs, golden brown. Length of forewing 14 mm, length of hind wing 11 mm (n = 1). Tibial spur formula 2,2,4. — Genitalia: Sternum VIII, in ventral view, with a sclerotized rectangular plate; anterior margin straight, posterior margin brown and slightly concave mesally (Fig. 21A). Segment IX sclerotized dorsally, subtrapezoidal, posterior margin subtruncate, dorsal process small. Preanal appendages, in dorsal view, small, digitate, apically rounded, and setose; in lateral view, short, digitate, with distinct subquadrate and sclerotized lobe, bearing an undistinctive minute sensilla-bearing process below each lamella (Fig. 21B). Lamellae well developed, sclerotized, flap-like (Fig. 21A, B). Gonopod plate subtriangular and membranous, with apicomesal process short and striate. Spermathecal sclerites elongate, broad, and bell-shaped (Fig. 21A, B). — Larva and pupa unknown.

Figure 19.

Triplectides paragracilis sp. nov., male wings (DNA voucher ENT5919). A Forewing; B Hind wing; C Forewing cross veins, in detail; D Hind wing fork I. — Abbreviations: see legend Figure 2.

Figure 20.

Triplectides paragracilis sp. nov., male genitalia (holotype, DNA voucher ENT4360). A Lateral view; B Dorsal view; C Ventral view (detail of small tooth-like projection at base of mesal lobe of inferior appendage); D Phallic apparatus, ventral view; E Phallic apparatus, lateral view.

Figure 21.

Triplectides paragracilis sp. nov., female genitalia (DNA voucher ENT5920). A Ventral view; B Lateral view.

Etymology.

The specific epithet is a reference to the close similarity of the new species to Triplectides gracilis. Derived from the Greek ‘para’ = beside or near.

Distribution.

Brazil (Rio de Janeiro State).

Habitat.

Specimens of the new species were collected in preserved streams of 2^nd to 4^th order covered by Atlantic Forest. Adults were collected during the night by light traps.

Remarks.

Although T. paragracilis sp. nov. is very similar to T. gracilis and occurs sympatrically with it, the new species differs from the latter by the mesal lobe of the inferior appendages with a small tooth-like projection which may or may not bear setae. This feature can initially be confused with the mesal lobe of T. iguassu sp. nov., which possesses a more prominent tooth without setae. Another distinguishing characteristic of the new species from their congeners is the presence of a distinct petiole on fork I of the forewing, which is absent in T. gracilis. Furthermore, the preanal appendages of the new species are oblong, whereas in T. gracilis they are digitate and apically rounded. Finally, another characteristic is in relation to the dorsal region of segment IX which is trapezoidal with a small protuberance mesally in the new species, while in T. gracilis it is triangular.

3.2.8. Triplectides puri sp. nov.

https://zoobank.org/DBD1B704-8F97-406B-A695-5506CEBA0A81

Figures 22, 23, 24

Henriques-Oliveira et al. 2020: 46 [as Triplectides misionensis Holzenthal, 1988].

Type material.

Holotype: BRAZIL • ♂; Espírito Santo, Dores do Rio Preto, Pedra Menina, Parque Nacional do Caparaó, Rio São Domingos, Cachoeira da Farofa; 20°28′19.20″S 41°49′41.90″W; alt. 1,964 m; 25 Jan. 2014; white sheet; A.L.H. Oliveira, J.L. Nessimian leg.; [DNA voucher ENT3220]; DZRJ TRICHOPTERA9229. — Paratypes: BRAZIL • 1 ♀; same data as for holotype; DZRJ TRICHOPTERA9323 • 1 larva; same data as for holotype; 27 Mar. 2012; A.LH. Oliveira leg.; [DNA voucher ENT3231]; DZRJ TRICHOPTERA9230 • 4 larvae; same data as for preceding; DZRJ TRICHOPTERA9235 • 2 larvae; same data as for preceding; MNRJ • 1 ♂: Minas Gerais, Alto Caparaó, PARNA do Caparaó, Cachoeira Bonita; 20°24′4.9″S 41°50′13.3″W; alt. 1,709 m; 05 Oct. 2010; L.L Dumas, J.L. Nessimian leg.; DZRJ TRICHOPTERA9231 • 1 ♂: Minas Gerais, Alto Caparaó, PARNA do Caparaó, 2^nd order tributary of Rio José Pedro; 20°24′35.00″S 41°50′56.70″W; alt. 1,792 m; 04 Apr. 2016; JL Nessimian, A.L.H. Oliveira, A. Antunes, A.A. Alves, J. Queiroz leg.; light trap; DZRJ TRICHOPTERA9232 • 1 ♂: Minas Gerais, Alto Caparaó, PARNA do Caparaó, Vale Encantado, Rio José Pedro; 20°24′38.1″S 41°50′03.6W; alt. 1,912 m; 05 Oct 2010; B. Clarkson, I.C. Gonçalves leg.; MNRJ • 1 ♂: Minas Gerais, Alto Caparaó, PARNA Caparaó, Vale Verde, Rio Caparaó; 20°25′11.6″S 41°50′44.8″W; alt. 1,306 m; 05 Oct. 2010; L.L. Dumas, J.L. Nessimian leg.; DZRJ TRICHOPTERA9234.

Description.

Adult male. General color golden brown (in alcohol). Antennae, palps, and legs, golden brown. Wings brown to golden brown. Forewings with forks I and V present (Fig. 22A); discoidal cell slightly enlarged apically, cross vein s almost straight, cross vein r-m short and positioned anteriorly to m-cu (Fig. 22D) or both cross veins almost aligned (Fig. 22C). Hind wings broad, with forks I, III, and V present (Fig. 22B); fork I petiolate (Fig. 22E). Length of forewing 11–12 mm, length of hind wing 8–10 mm (n = 4). Tibial spur formula 2,2,4. — Genitalia: Segment IX annular, in lateral view, narrow, enlarged dorsally with setose area (Fig. 23A); in dorsal view, produced mesally and laterally, bearing setose area laterally; dorsal process absent (Fig. 23B). Preanal appendages digitate, long, extending beyond half the length of tergum X, setose, in lateral view (Fig. 23A). Tergum X, in lateral view, elevated at base with median area less sclerotized than apical area (Fig. 23A); in dorsal view, wide at base, narrower at apex, apicomesal incision wide reaching less than half the length of the tergum X and forming an oval opening, apex rounded (Fig. 23B). Inferior appendages, long, extending beyond tergum X, bearing very long setae (Fig. 23A, C); 1^st article, in lateral view, wide at base, slightly constricted at middle-length, with apical portion narrow and apically rounded (Fig. 23A); apicodorsal lobe digitate, long, extending beyond 2^nd article, with very long setae (Fig. 23A, C); basoventral lobes digitate, long, extending beyond the insertion of 2^nd article, rounded and bearing long setae (Fig. 23A, C); in ventral view, mesal lobe shorter than basoventral lobe, basal portion subrectangular, apicomesal corner produced in a digitate process, narrow and acute apically, lateral margin almost straight apically (Fig. 23C); 2^nd article slightly widened at base, slender, curved inwards, narrowing to an acute apex (Fig. 23C). Phallic apparatus simple, tubular, with phallotremal sclerite small, spine-like, positioned apically (Fig. 23D, E). — Adult female. General color pale brown (in alcohol). Antennae, palps, and legs, pale brown. Length of forewing 11.0 mm, length of hind wing 9.0 mm (n = 1). Tibial spur formula 2,2,4. — Genitalia: Sternum VIII, in ventral view, with a subrectangular, sclerotized plate; anterior margin with a concave, and posterior margin straight (Fig. 24A). Segment IX sclerotized dorsally, posterior margin subtruncate, and slightly rounded. Preanal appendages, in dorsal view, small, sub-oval, setose; in lateral view, subtriangular, roof-shape (Fig. 24B), without sensilla-bearing processes (Fig. 24A, B). Lamella oval, flap-like, and internally concave; in ventral view directed mesad (Fig. 24B). Gonopod plate subtrapezoidal, slightly sclerotized, with apicomesal process short and slightly rugose. Spermathecal sclerite broad, bell-sharped in ventral view, and elongate in lateral view. (Fig. 24A). — Larva. Length up to 12 mm (n = 3) (Fig. 25A). — Head: Coloration (in alcohol) dark brown, almost homogeneous, with pale oval area around stemmata (Fig. 25B), subrectangular, slightly flattened dorsally (Fig. 25B). Muscle scars reddish brown. Labrum yellowish brown, sub-oval (Fig. 25B). Mandible asymmetrical, dark, typical for Triplectides. Submentum rectangular. Ventral apotome short, subtriangular, anterior portion widened and posterior portion narrowed and truncate (resembling a champagne flute glass) (Fig. 25B). — Thorax: Pronotum brown, with muscle scars pale; anterior margin crenulate, lateral margin slightly produced (Fig. 25C, D). Mesonotum pale brown, almost covered by a pair of large sclerites: sa1 each with a single seta; sa2 each with 3 setae: (1 mesal and 1 lateral mesal long setae, and 1 posterior very short); sa3 each with 13–17 setae. Metanotum weakly sclerotized, covered by 3 pair of sclerites: sa1 pair subquadrate, bearing each a long seta, sa2 pair subquadrate, with a pair of long setae, sa3 sclerites elongate, oval, bearing each with 7–10 setae. Prosternum trapezoidal. Mesosternum with a pair of subrectangular sclerites, curved laterally (Fig. 25E). Metasternum with a setal area bearing 7 setae (Fig. 25E). Foretrochantin with anterodorsal margin almost straight, with corner pointed and upturned, anteroventral margin straight and corner rounded (Fig. 25C). Legs yellowish brown, setose (Fig. 25G). — Abdomen: Gills simple, present on segments II–VI; segments II–IV with dorsal, lateral, and ventral filaments; segment V–VI with dorsal and lateral filaments (Fig. 25H). Segments III–VIII with lateral fringes. Segment VIII with a pair of posteromesal short setae. Segment IX dorsal sclerite with 6 long setae on posterior margin and 2 pairs of very short, lateral setae behind those, and one anterolateral short seta at each side of the sclerite (Fig. 25F); anal claws single, large, and pointed with a very small dorsal accessory hook (Fig. 25F). — Larval case: Length up to 20 mm. All larvae of T. puri sp. nov. were found occupying a discarded case of Marilia sp. (Odontoceridae) (Fig. 25I). — Pupa. Unknown.

Figure 22.

Triplectides puri sp. nov., male wings (paratype). A Forewing; B Hind wing; C and D Forewing cross veins, in detail (D DNA voucher 3220); E Hind wing fork I, in detail. — Abbreviations: see legend Figure 2.

Figure 23.

Triplectides puri sp. nov., male genitalia (holotype). A Lateral view; B Dorsal view; C Ventral view; D Phallic apparatus, ventral view; E Phallic apparatus, lateral view.

Figure 24.

Triplectides puri sp. nov., female genitalia (paratype). A Ventral view; B Lateral view.

Figure 25.

Triplectides puri sp. nov., larva (DNA voucher ENT3231). A Habitus, dorsal view; B Head, dorsal, ventral, and lateral views; C Pronotum and trochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Left fore-, mid-, and hind legs; H Diagram of distribution of abdominal gills (I–IX = abdominal segments); I Larval case.

Etymology.

The specific epithet ‘puri’ comes from the Coroado indigenous language, meaning audacious. The Puris are a Brazilian indigenous group belonging to the Macro-Jê linguistic branch, originally inhabiting the ES, RJ, MG, and SP States in southeast Brazil.

Distribution.

Brazil (Espírito Santo and Minas Gerais states).

Habitat.

This species was found inhabiting wide streams, with crystalline waters, and stony bottoms, with many rapids and marginal vegetation composed of Atlantic Forest or highland vegetation (campos de altitude).

Remarks.

The male of Triplectides puri sp. nov. can be confused with the one of T. misionensis Holzenthal, 1988 by the mesal lobe of the inferior appendages with a narrow apical portion (Fig. 22A). Based on the original description of T. misionensis provided by Holzenthal (1988) and based on photographs of the holotype (USNMENT 01028388), deposited in the National Museum of Natural History (NMNH), Washington, DC, USA, we found consistent differences on this structure between these two species. In T. misionensis the mesal lobe is broad basally with a small, sclerotized basomesal point and a very narrow and divergent apical portion, but in T. puri sp. nov., the mesal lobe has the apical portion much more acute and short and the basal portion larger and subrectangular (Fig. 22A). The larva of the new species can be distinguished from its congeners based on the following characteristics: head dark brown, almost homogeneous, subrectangular, slightly flattened dorsally (Fig. 24B); labrum yellowish brown, subtrapezoidal, submentum rectangular and ventral apotome short, subtriangular, like a Champagne flute glass, wide at anterior portion and posterior portion truncate (Fig. 24B). DNA sequences were obtained only for two specimens, an adult male and a larva, but they share the same haplotype for both gene fragments sequenced, thus allowing us to associate this larva.

3.2.9. Triplectides cipo Henriques-Oliveira & Dumas, 2015

Figure 26

Material examined.

BRAZIL • 1 ♂; Minas Gerais, Itabira, Ipoema, road to Morro Redondo, Córrego do Macuco; 19°25′15.3″S 43°28′42.1″W; alt. 705 m; 16 Dec. 2019; A.L.H. Oliveira, A.P.M. Santos, A.A. Almeida, B.M. Cavalcante leg.; white sheet; [DNA voucher ENT5344]; DZRJ TRICHOPTERA9187 • 1 ♂; Minas Gerais, Jaboticatubas, Parque Nacional da Serra do Cipó, Córrego das Pedras; 19°22′16.70″S 43°36′02.80″W; alt. 766 m; 2 Mar. 2013; A.L.H. Oliveira, D.M. Takiya, A.P.M. Santos, B.H. Lanzelotti, B.M. Camisão leg.; Malaise trap; [DNA voucher ENT1128]; DZRJ TRICHOPTERA9185 • 1 larva; Minas Gerais, São João Batista do Glória, Parque Nacional da Serra da Canastra, Ribeirão Grande; 20°30′19.79″S 46°31′10.48″W; alt. 747 m; 24 Mar. 2015; A.L.H. Oliveira leg.; [DNA voucher ENT3230], DZRJ TRICHOPTERA9189 • 1 ♂; Minas Gerais, São Roque de Minas, Serra da Canastra, afluente do Rio das Posses near to Pousada Dois Irmãos; 20°14′38.49″S 46°38′38.05″W; alt. 833 m; 01 Sep. 2015; J.L. Nessimian, L.L. Dumas, I.C. Rocha, P.M. Souto, N. Ferreira-Jr. leg.; [DNA voucher ENT3217]; DZRJ TRICHOPTERA9186.

Description.

Adult. For a full description of male and female adults of T. cipo see Henriques-Oliveira and Dumas (2015). — Larva. Length up to 15.5 mm (n = 1) (Fig. 26A). — Head: Coloration (in alcohol) golden to reddish brown with pale brown oval area around stemmata; almost rectangular (Fig. 26A). Muscle scars pale brown. (Fig. 26B). Labrum reddish brown, subtrapezoidal with 8 setae (mesal pair shorter than others). Mandibles, asymmetrical, dark, typical for Triplectides. Submentum oval. Ventral apotome subtriangular, wide anteriorly and narrower posteriorly, slightly constricted at mid-length, rounded apically (Fig. 26B). — Thorax: Pronotum reddish brown with muscle scars pale brown; anterior margin almost smooth, lateral margin smooth and rounded, posterior margin dark (Fig. 26C, D). Mesonotum with same colors of pronotum, almost covered by a pair of large sclerites: sa1 each with a single long seta; sa2 each with 3 setae: (one long mesal and 2 short), sa3 each with 5 setae (1 long and 4 short); metanotum covered by 5 sclerites: sa1 quadrate, bearing a single seta, sa2 seems fused, forming a single sclerite, weakly sclerotized, with a pair of long setae, sa3 sclerites elongate, oval, each bearing 3 setae of about the same size (Fig. 26D). Prosternum trapezoidal. Mesosternum with a pair of subtriangular sclerites curved laterally (Fig. 26E). Metasternum with a dark, sclerotized setal area, bearing about 10 setae (Fig. 26E). Foretrochantin with distal portion of the anterior margin very curved, pointed, and upturned, with posterior margin almost straight and truncate (Fig. 26C). Legs pale brown and setose (Fig. 26G). — Abdomen: Gills simple, present on segments II–VIII; segments II–VIII with dorsal, lateral, and ventral filaments (Fig. 26H). Segment I with a pair of anteromesal setae; segments III–VIII with lateral fringes. Segment IX dorsal sclerite with 6 long setae on its posterior margin, and 2 pairs of very short setae behind those, 1 anterolateral seta on each side of the sclerite (Fig. 26E). Anal claw single, large and acute, with a very small dorsal accessory hook (Fig. 26E). — Larval case: Length up to 25 mm. A simple hollow twig or small sticks (Fig. 26I). — Pupa unknown.

Figure 26.

Triplectides cipo Henriques-Oliveira & Dumas, 2015, larva (DNA voucher ENT3230). A Habitus, dorsal view; B Head, dorsal, ventral, and lateral views; C Pronotum and trochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Left fore-, mid-, and hind legs; H Diagram of distribution of abdominal gills (I–IX = abdominal segments); I. Larval case.

Distribution.

Brazil (Minas Gerais State).

Habitat.

Larvae were collected in areas with characteristic Cerrado vegetation, in stony streams originally formed by quartzite or limestone rock, with many rapids, shallow waters, and very sunny.

Remarks.

In general, larvae of T. cipo are very similar to other Triplectides larvae showing the head and body sclerites golden to reddish brown, with head appearing rectangular. The main characteristics to identify individuals of T. cipo are: submentum oval and ventral apotome subtriangular, widened anteriorly and narrower in posterior portion, with a rounded tip (Fig. 26B); foretrochantin very curved anterodorsally, pointed and upturned with anteroventral margin rounded (Fig. 26C), beyond the position of setal area in mesonotum; metanotum composed by 5 sclerites (Fig. 26D); and abdominal gills present on segments II–VIII with dorsal, lateral, and ventral filaments.

3.2.10. Triplectides ultimus Holzenthal, 1988

Figure 27

Material examined.

BRAZIL • 1 ♂; Minas Gerais, Itamonte, Parque Nacional de Itatiaia, Fazenda Cabeceira do Aiuruoca, Rio Aiuruoca; 22°20′57.93″S 44°41′37.60″W; 24 Nov. 2011; J.L. Nessimian leg.; [DNA voucher ENT740]; DZRJ TRICHOPTERA9182. • 1 larva; Minas Gerais, Itamonte, Parque Nacional de Itatiaia, Córrego do Brejo da Lapa; 22°21’41.83”S 44°42′26.19”W; alt. 2,242 m; 07 Nov. 2011; A.L.H. Oliveira leg.; [DNA voucher ENT2314]; DZRJ TRICHOPTERA9183 • 1 ♂; Rio de Janeiro, Resende, Parque Nacional de Itatiaia, Abrigo Massena; 22°24′29.80″S 44°39′04.50″W; alt. 2,210 m; 26 Oct. 2013; light trap; J.L. Nessimian leg.; [DNA voucher ENT3718]; DZRJ TRICHOPTERA9184.

Description.

Adult. For a full description of male and female adults of T. ultimus see Holzenthal (1988). — Larva. Length up to 15 mm (n = 1) (Fig. 27A). Head: Anterior region of the head brown to golden brown (in alcohol), with a pale oval area around the stemmata (Fig. 27B); almost rectangular, slightly enlarged posteriorly; many pale muscle scars on posterior portion of the head (Fig. 27B). Labrum brown, subtrapezoidal, with 3 pairs of long setae. Mandibles asymmetrical, dark, typical for Triplectides (right mandible with 6 teeth around a concavity and left mandible with 5 teeth). Submentum subrectangular. Ventral apotome subtriangular, widened anteriorly, slightly constricted at mid-length, and narrowing at posterior portion to an acute tip (Fig. 27B). — Thorax: Pronotum, mesonotum, and legs, yellowish brown (Fig. 27D). Pronotum with muscle scars pale (Fig. 27D); anterior margin crenulate, lateral margin slightly produced and pointed (Fig. 27C, D). Mesonotum very pale, almost covered by a pair of large sclerites: sa1 each with single seta; sa2 each with 3 setae (2 very long mesal setae and 1 posterior very short); sa3 each with 6 setae (3 anterior setae, 2 very long mesal and 1 posterior short). Metanotum covered by 5 sclerites: sa1 pair, subquadrate, bearing each a single seta, sa2 seems fused, forming one sclerite, weakly sclerotized, with pair of long setae, sa3 sclerites elongate, oval, bearing each with 4 setae (1 very long and others short) (Fig. 27D). Prosternum subtrapezoidal. Mesosternum with a pair of sclerites subtriangular curved laterally. Metasternum bearing about 12 setae (Fig. 27E). Foretrochantin sinuous with anterodorsal margin slightly curved, narrowed at the tip and upturned, and anteroventral margin almost straight (Fig. 27C). Legs yellowish brown and setose (Fig. 27G). — Abdomen: Gills simple, present on segments II–VIII: segments II–VII with dorsal, lateral, and ventral filaments; segment VIII with ventral filaments (Fig. 27H). Segment I-II with a pair of small setae in posterior portion; segments III–VIII with lateral fringes. Segment VIII with a pair of long posteromesal setae. Segment IX dorsal sclerite with 6 long setae on its posterior margin, and 2 pairs of very short setae behind those, and one anterolateral short seta at each side of the sclerite (Fig. 27F). Anal claws single, large and, acute, with a small dorsal accessory hook (Fig. 27F). — Larval case: Length up to 26 mm. A hollow stick with several small sticks glued close to the opening (Fig. 27I). — Pupa unknown.

Figure 27.

Triplectides ultimus Holzenthal, 1988, larva (DNA voucher ENT2314). A Habitus, lateral view; B Head, dorsal, ventral, and lateral views; C Pronotum and trochantin, lateral view; D Thorax, dorsal view; E Thorax, ventral view; F Abdominal segments VII–X, dorsal and lateral views; G Left fore-, mid-, and hind legs; H Diagram of distribution of abdominal gills (I–IX = abdominal segments); I Larval case.

Distribution.

Brazil (Minas Gerais and Rio de Janeiro states).

Habitat.

Specimens were collected in streams of different orders with crystalline and alkaline waters at high altitudes in the Atlantic Forest, mainly in the Serra da Mantiqueira region.

Remarks.

In general, the larva of T. ultimus is very similar to other Triplectides larvae showing the head and body sclerites brown to golden brown, with head rectangular and enlarged at posterior area. The main characters to identify larvae of this species are the narrow ventral apotome, subtriangular with anterior portion slightly widened and narrower in posterior portion, with a pointed tip; pronotum with muscle scars pale and anterior margin crenulate with lateral margin slightly produced and pointed; metanotum covered by 5 sclerites: sa1 pair, subquadrate, bearing each a single seta, sa2 seems fused in only one sclerite, weakly sclerotized, and sa3 sclerites elongate, and oval,; metasternum bearing about 12 setae; foretrochantin sinuate with anterodorsal margin slightly curved, narrowed at tip, and upturned and anteroventral margin almost straight; and abdominal gills present on segments II–VIII: II–VII with dorsal, lateral, and ventral filaments and VIII with ventral filaments only.

3.3. New records of Brazilian Triplectides

3.3.1. Triplectides cipo Henriques-Oliveira & Dumas, 2015

Material examined.

BRAZIL • 2 ♂; Mato Grosso do Sul, Bonito, Hotel Cabanas, Córrego Formosinho; 21°10′16.2″S 56°26′47.1″W; 8–12 Sep. 2013; Malaise trap; D.M. Takiya, A.P.M. Santos leg.; DZRJ TRICHOPTERA9188 • 1 ♂, 2 ♀; same data as for preceding; DZRJ TRICHOPTERA9271.

Remarks.

Triplectides cipo was described from the Serra do Cipó mountain range recorded in several streams from the Cerrado biome in Minas Gerais State. Desiderio et al. (2017) recorded this species in the Chapada das Mesas, Maranhão State, and this species is herein recorded to Mato Grosso do Sul State.

Distribution.

Brazil (Minas Gerais, Maranhão, Mato Grosso do Sul States).

3.3.2. Triplectides flintorum Holzenthal, 1988

Material examined.

BRAZIL • 1 ♂; Amazonas, Ipixuna, Rio Liberdade, Comunidade Santa Catarina; 07º19′46″S 071º50′46″W; alt. 169 m; 10 May 2011; light trap; R. Cavichioli, C.C. Gonçalves, D.M. Takiya leg.; [DNA voucher ENT2307]; DZRJ TRICHOPTERA9246.

Remarks.

Triplectides flintorum is known to occur in Mexico, Central America, and northern South America. In general, T. flintorum is quite similar to T. gracilis due to some features of male genitalia, but it differs by having a fork I present with a long petiole, and a straight mesal lobe of the inferior appendages, slightly tapered, with blunt apices. Here, T. flintorum is newly recorded for Brazil from the Amazonian Region.

Distribution.

Brazil (Amazonas), Colombia, Costa Rica, Ecuador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Peru, Suriname, Venezuela.

3.3.3. Triplectides maranhensis Desiderio, Barcelos-Silva & Pes, 2017

Material examined.

BRAZIL • 2 ♂; Amazonas, Manaus, ZF2-km 14; 02°35′21″S 60°6′55″W; 10–30 Sep. 2016; Malaise trap in small igarapé; J.A. Rafael, F.F. Xavier leg.; DZRJ TRICHOPTERA9260 • 1 ♂; Pará, Benevides, Estrada Vicinal, Ramal Taiassuí, Igarapé Mato Pirituba (stream); 1°23′43.5″S 48°15′4.3″W; alt. 19 m; 11–12 Nov. 2017; UV light trap; M.P. Rozo, A.A. Alves leg.; [DNA voucher ENT5932]; DZRJ TRICHOPTERA9251.

Remarks.

Triplectides maranhensis was previously recorded from the Maranhão and Piauí states, occurring in streams of the Caatinga biome (Santos et al. 2023). Here, its distribution is expanded, being newly recorded for the state of Pará, from streams in the Amazonian region.

Distribution.

Brazil (Maranhão, Pará, Piauí States).

4. Discussion

Currently, over 900 caddisfly species are known from Brazil (Santos et al. 2025), but estimates indicate over 1,600 species could occur in the country (Santos et al. 2020). Brazilian leptocerids are still scarcely known, with large genera as Nectopsyche Müller, 1879 and Oecetis McLachlan, 1877 probably including a high number of undescribed species (Santos et al. 2020). Triplectides specimens are conspicuous, relatively easy to find and collect in the field, and the Neotropical species were revised by Holzenthal (1988). Until now, the Neotropical Triplectides were represented by 18 described species (Desiderio et al. 2020), 11 of them occurring in Brazil (Santos et al. 2025). Even so, after studying specimens from many localities and re-examining their morphology, we found seven new species described here, plus new species records, increasing the number of Triplectides species occurring in Brazil to 19, 25 in the Neotropics. This indicates how far we still are from having a good knowledge on caddisfly diversity in Brazil.

Based on a combination of morphology and DNA sequences, we found a hidden diversity in Brazilian Triplectides. Taxonomic studies of caddisfly using sequences of COI for species delimitation or larval associations usually reveal distinguishable intra- and interspecific divergences (e.g., Barcelos-Silva et al. 2018; Moreira et al. 2022; Santos et al. 2016; Santos and Takiya 2021), the so-called “barcode gap”. When analyzing K2P divergences of COI sequences for Neotropical caddisflies, most works found maximum intraspecific distances lower than 10%, e.g. 5.9% for Chilean Smicridea (Pauls et al. 2010) and 7.0 for Synoestropsis (Barcelos-Silva et al. 2018) among the Hydropsychidae, and 4.8% for Brazilian Metrichia (Santos et al. 2016) and less than 2.0% for Peruvian Byrsopteryx (Santos and Takiya 2021) among the Hydroptilidae. For some Neotropical Triplectides, we found relatively high intraspecific divergences (> 10%) which exceeds frequently observed interspecific divergences. In the species complex including T. bandeira sp. nov., maximum K2P intraspecific divergence of COI was over 20%. Since we were not able to find morphological evidence to support distinct taxa within the complex, we expect further analysis with more specimens will reveal potential cryptic species.

Information on immature stages of Neotropical caddisflies is even more scarce when compared to adults, and only around 9% of the species in this region have the immature stages described (Pes et al. 2018). For Neotropical Triplectides, the larvae were previously known for four species (Sattler 1963; Holzenthal 1988; Sganga et al. 2013). Now, using DNA sequences, we were able to associate immatures to adults of six more species.

5. Acknowledgements

We thank to Dr. Bruna M.S. Cavalcante for analyzing and taking photos from some Triplectides types deposited in the National Museum of Natural History (NMNH), Smithsonian Institution. We are grateful to Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio) for issuing collecting permits. This work was supported by Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ, Proc. E-26/010.002252/2019). ALHO thanks the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and FAPERJ for providing financial supports (CNPq Proc. 118420/2017-8 and FAPERJ Proc. E26/ 202.492/2019). DMT was supported through a research productivity from CNPq (Proc. 314557/2021-0) and a Cientista do Nosso Estado from FAPERJ (Proc. E-26/200.503/2023) fellowships. JLN was supported by fellowships: CNPq (Proc. 474755/2012-6, and Proc. 420573/2016-0), and FAPERJ (E-26-111.389/2010, E-26 110.466/2014, and E-26 210.665/2016).

6. References

Baptista DF, Buss DF, Egler M, Giovanelli A, Silveira MP, Nessimian JL (2007) A multimetric index based on benthic macroinvertebrates for evaluation of Atlantic Forest streams at Rio de Janeiro State, Brazil. Hydrobiologia 575: 83–94. https://doi.org/10.1007/s10750-006-0286-x

Barbour MT, Gerritsen J, Snyder BD, Stribling JB (1999) Rapid Bioassessment Protocols for Use in Streams and Wadeable Rivers: Periphyton, Benthic Macroinvertebrates and Fish, Second Edition. EPA 841-B-99-002. U.S. Environmental Protections Agency, Office of Water, Washington, DC.

Barcelos-Silva P, Pes AMO, Andrade-Souza V, Holzenthal RW (2018) Associating larvae and adults of the Neotropical caddisfly genus Synoestropsis Ulmer (Trichoptera: Hydropsychidae) using morphology and DNA mitochondrial sequences. Zoologischer Anzeiger 277: 169–189. https://doi.org/10.1016/j.jcz.2018.08.002

Blahnik RJ, Holzenthal RW, Prather AL (2007) The lactic acid method for clearing Trichoptera genitalia. In: Bueno-Soria J Barba-Álvarez R Armitage BJ (Eds) Proceedings of the 12^th International Symposium on Trichoptera. The Caddis Press, Columbus, Ohio, USA, pp. 9–14.

Burmeister H (1839) Handbuch der Entomologie. Zweiter Band, Zweite Abtheilung. Berlin: Theodor Christian Friedrich Enslin, Berlin, pp. i–xii + 397–1050. https://doi.org/10.1590/S0085-56262004000100022

Ceneviva-Bastos M, Prates DB, Romero RM, Bispo PC, Casatti L (2017) Trophic guilds of EPT (Ephemeroptera, Plecoptera, and Trichoptera) in three basins of the Brazilian Savanna. Limnologica 63: 11–17. https://doi.org/10.1016/j.limno.2016.12.004.

Danforth BN, Ji S (1998) Elongation factor-1a occurs as two copies in bees: implications for phylogenetic analysis of EF-1α sequences in insects. Molecular Biology and Evolution 15(3): 225–235. https://doi.org/10.1093/oxfordjournals.molbev.a025920.

Desidério GR, Barcelos-Silva P, Souza WRM, Pes AMO, Ázevedo CAS (2017) Caddisflies (Insecta: Trichoptera) from Maranhão State, Northeast Region, Brazil: a new species, checklist, and new geographical records. Zootaxa 4421(2): 151–171. https://doi.org/10.11646/zootaxa.4221.2.1

Desidério GR, Pes AM, Barcelos-Silva P, Hamada N (2020) Triplectides Kolenati (Trichoptera: Leptoceridae) from Brazil: a new species, new records and an identification key. European Journal of Taxonomy 677: 1–11. https://doi.org/10.5852/ejt.2020.677

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. PMID: 7881515

Gonçalves FB, Menezes MS (2011) A comparative analysis of biotic indices that use macroinvertebrates to assess water quality in a coastal river of Paraná state, southern Brazil. Biota Neotropica 11(4). https://www.biotaneotropica.org.br/BN/article/view/872

Henriques-Oliveira AL, Dumas LL (2015) Two new species of Triplectides (Trichoptera: Leptoceridae) from South America. Zoologia 32(1): 66–70. http://doi.org/10.1590/S1984-46702015000100010

Henriques-Oliveira AL, Rocha IC, Nessimian JL (2019) Leptoceridae (Insecta, Trichoptera) from Serra da Canastra Mountain Range, southeast Brazil: diversity, distribution, and description of two new species. Neotropical Entomology 48: 277–289. https://doi.org/10.1007/s13744-018-0633-4

Henriques-Oliveira AL, Dumas IL, Nessimian JL (2020) Leptoceroidea (Insecta: Trichoptera: Integripalpia) from Serra do Caparaó, southeast Brazil, including a new species of Atanatolica Mosely (Leptoceridae). Zootaxa 4763(1): 031–049. https://doi.org/10.11646/zootaxa.4763.1.3

Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolutuon 35(2): 518–522. https://doi.org/10.1093/molbev/msx281

Hogg ID, Smith BJ, Banks JC, Dewaard JR, Hebert PDN (2009) Testing use of mitochondrial COI sequences for the identification and phylogenetic analysis of New Zealand caddisflies (Trichoptera). New Zealand Journal of Marine and Freshwater Research 43: 1137–1146. https://doi.org/10.1080/00288330.2009.9626536

Holzenthal RW (1988) Systematics of Neotropical Triplectides (Trichoptera: Leptoceridae). Annals of the Entomological Society of America 81(2): 187–208. https://doi.org/10.1093/aesa/81.2.187

Holzenthal RW, Calor AR (2017) Catalog of the Neotropical Trichoptera (Caddisflies). ZooKeys 654: 1–566. https://doi.org/10.3897/zookeys.654.9516

Ito T, Kuhara N, Katsuma N (2013) The genus Adicella McLachlan (Trichoptera, Leptoceridae) in Japan. Zootaxa 3635(1): 027–039. https://doi.org/10.11646/zootaxa.3635.1.3

Kalyaanamoorthy S, Minh BQ, Wong TKF, Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285

Kolenati FA (1859) Genera et species Trichopterorum, Pars Altera. Nouveaux Mémoires de la Société Impériale des Naturalistes de Moscou 11: 141–296.

Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096.

Leach WE (1815) Entomology. In: Brewster D (Ed.) The Edinburgh Encyclopedia. William Blackwood, Edinburgh, pp. 52–172.

Malm T, Johanson KA (2011) A new classification of the long-horned caddisflies (Trichoptera: Leptoceridae) based on molecular data. BMC Evolutionary Biology 11(10): 1–17. https://doi.org/10.1186/1471-2148-11-10

McLachlan R (1877) A Monographic Revision and Synopsis of the Trichoptera of the European Fauna. Part 6. John van Voorst, London, pp. 281–348, pls. 32–37.

Milne MJ (1938) The “metamorphotype method” in Trichoptera. Journal of the New York Entomological Society 48: 434–437.

Moreira PD, Dumas LL, Rozo MP, Desidério GR, Takiya DM (2022) Integrative taxonomy supports two new species of Chimarra Stephens, 1829 from Brazil (Trichoptera: Philopotamidae). Arthropod Systematics & Phylogeny 80: 169–185. https://doi.org/10.3897/asp.80.e76559

Morse JC (2023) Trichoptera World Checklist. https://trichoptera.org/checklist-downloads#ff4f285b-55fa-4381-8167-2e60f1a3ba01 [Accessed 15 December 2024]

Morse JC, Frandsen PB, Graf W, Thomas JA (2019) Diversity and ecosystem services of Trichoptera. Insects 10: 125. https://doi.org/10.3390/insects10050125

Morse JC, Neboiss A (1982) Triplectides of Australia (Insecta: Trichoptera: Leptoceridae). Memoirs of the National Museum Victoria 43: 61–98. https://doi.org/10.24199/j.mmv.1982.43.05

Mosely ME (1936) A revision of the Triplectidinae, a subfamily of the Leptoceridae (Trichoptera). Transactions of the Entomological Society of London 85: 91–129.

Müller F (1879) Über Phryganiden (letters to his brother). Zoologischer Anzeiger 2: 38–40 + 180–182 + 283–284 + 404–407.

Müller F (1921) Briefe und noch nicht veröffentlichte Abandlungen aus dem Nachlass 1854–1897. In: Möller A (Ed.) Fritz Müller, Werke, Briefe und Leben. Gustav Fischer, Jena, pp. 383–642.

Nessimian JL, Santos APM, Sampaio BHL, Dumas LL, Pes AMO, Ferreira Jr. N (2024) The collapsible light trap: a portable Pennsylvania light trap for collecting aquatic insects. Anais da Academia Brasileira de Ciências 96(3): e20230784. https://doi.org/10.1590/0001-3765202420230784

Nguyen LT, Schmidt HA, Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1899/09-108.1

Pauls SU, Blahnik JR, Zhou X, Wardwell CT, Holzenthal RW (2010) DNA barcode data confirm new species and reveal cryptic diversity in Chilean Smicridea (Smicridea) (Trichoptera: Hydropsychidae). Journal of the North American Benthological Society 29: 1058–1074. https://doi.org/10.1899/09-108.1

Pes AM, Holzenthal RW, Sganga JV, Santos APM, Barcelos-Silva P, Camargos LM (2018) Chapter 10. Order Trichoptera. In: Hamada N Thorp JH Rogers DC (Eds) Keys to Neotropical Hexapoda Thorp and Covich’s Freshwater Invertebrates, Volume III,. 4th Edition. Academic Press, pp. 237–324. https://doi.org/10.1016/B978-0-12-804223-6.00010-X

Puillandre N, Brouillet S, Achaz G (2021) ASAP: assemble species by automatic partitioning. Molecular Ecology Resources 21: 609–620. https://doi.org/10.1111/1755-0998.13281

Ruiter DE, Boyle EE, Zhou X (2013) DNA barcoding facilitates associations and diagnoses for Trichoptera larvae of the Churchill (Manitoba, Canada) área. BMC Ecology 13(5): 1–39. https://doi.org/10.1186/1472-6785-13-5

Santos APM, Calor AR, Camargos LM, Desidério GR, Dumas LL, Henriques-Oliveira AL, Pereira R, Pes AMO, Quinteiro FB, Souza WRM, Vilarino A (2025) Trichoptera. In: Catálogo Taxonômico da Fauna do Brasil. PNUD. http://fauna.jbrj.gov.br/fauna/faunadobrasil/278 [Accessed on 29 January 2025]

Santos APM, Dumas LL, Henriques-Oliveira AL, Souza WRM, Camargos LM, Calor AR, Pes AMO (2020) Taxonomic Catalog of the Brazilian Fauna: order Trichoptera (Insecta), diversity and distribution. Zoologia 37: e46392. https://doi.org/10.3897/zoologia.37.e46392

Santos APM, Takiya DM (2021) Three new species of Byrsopteryx Flint microcaddisflies from Peru (Insecta: Trichoptera) including DNA-based larval associations. PeerJ 9: 1–26. https://doi.org/10.7717/peerj.12645

Santos APM, Takiya DM, Nessimian JL (2016) Integrative taxonomy of Metrichia Ross (Trichoptera: Hydroptilidae: Ochrotrichiinae) microcaddisflies from Brazil: descriptions of twenty new species. PeerJ 4: e2009. https://doi.org/10.7717/peerj.2009

Sattler W (1963) Eine neue Triplectides-Art (Leptoceridae, Trichoptera) aus dem brasilianischen Amazonasgebiet, ihre Metamorphosestadien und Bemerkungen zu ihrer Biologie. Beiträge zur Neotropischen Fauna 111: 20–33.

Sganga JL, Angrisano EB, Asaroff PE (2013) Preimaginal stages of Triplectides misionensis Holzenthal and Triplectides gracilis (Burmeister) (Trichoptera: Leptoceridae: Triplectidinae), with notes on the cases occupied by these species. Zootaxa 3616(1): 22–30. https://doi.org/10.11646/zootaxa.3616.1.2

Shackleton M, Webb JM (2013) A new description and association of a larva with the adult male of Pliocaloca fidesria Shackleton (Insecta: Trichoptera: Calocidae) from eastern Australia. Memoirs of the Queensland Museum 56(2): 593–600. https://doi.org/10.17082/j.2204-1478.56.2.2013-13

Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87(6): 651–701. https://doi.org/10.1093/aesa/87.6.651

Tierno-de-Figueroa JM, Gaetani B, Luzón-Ortega JM, López-Rodrigues MJ, Fochetti R (2011) On the identity of Isoperlacurtata (Plecoptera: Perlodidae): behavioural and molecular approaches show the existence of two separate species. Zootaxa 3000: 49–58. https://doi.org/10.11646/zootaxa.3000.1.3

Ulmer G (1905) Zur Kenntniss aussereuropäischer Trichopteren. Stettiner Entomologische Zeitung 66: 3–119.

Waringer J, Graf W, Pauls S, Vicentini H, Lubini V (2008) DNA based association and description of the larval stage of Drusus melanchaetes McLachlan, 1876 (Trichoptera: Limnephilidae: Drusinae) with notes on ecology and zoogeography. Limnologica 38: 34–42. https://doi.org/10.1016/j.limno.2007.09.001

Yang LF, Morse JC (2000) Leptoceridae (Trichoptera) of the People’s Republic of China. Memoirs of the American Entomological Institute 64: 1–301. https://open.clemson.edu/bio_pubs/55

Zhang J, Kapli P, Pavlidis P, Stamatakis A (2013) A general species delimitation method with applications of phylogenetic placements. Bioinformatics 29: 2869–2876. https://doi.org/10.1093/bioinformatics/btt499

Zhou X, Kjer KM, Morse JC (2007) Associating larvae and adults of Chinese Hydropsychidae caddisflies (Insecta: Trichoptera) using DNA sequences. Journal of the North American Benthological Society 26: 719–742. https://doi.org/10.1899/06-089.1

Zhou X, Robinson JL, Geraci CJ, Parker CR, Flint OS, Etnier DA, Ruiter DE, DeWalt RE, Jacobus LM, Hebert PDN (2011) Accelerated construction of a regional DNA-barcode reference library: caddisflies (Trichoptera) in the Great Smoky Mountains National Park. Journal of the North American Benthological Society 30(1): 131–162. http://dx.doi.org/10.1899/10-010.1

Supplementary materials

Supplementary material 1

Figures S1–S3

Henriques-Oliveira AL, Nessimian JL, Takiya DM, Santos APM(2025)

Data type: .zip

Explanation notes: Figure S1. Maximum likelihood tree based on concatenated COI and EF-1α nucleotide sequences. — Figure S2. Maximum likelihood tree based on COI sequences of Triplectides and other leptocerids analyzed in IQ-TREE. — Figure S3. Maximum likelihood tree based on EF-1α sequences of Triplectides and other leptocerids analyzed in IQ-TREE.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (1.60 MB)

Supplementary material 2

Tables S1–S3

Henriques-Oliveira AL, Nessimian JL, Takiya DM, Santos APM(2025)

Data type: .zip

Explanation notes: Table S1. List of species of Triplectides and other Leptoceridae with DNA sequences analyzed in this work, with respective specimen voucher code, life stage, sex, collecting locality, and GenBank® accession number. — Table S2. Pairwise distances (K2P) of COI sequences of Triplectides and related leptocerids analyzed. — Table S3. Pairwise distances (p-distance) of EF-1α sequences of Triplectides and related leptocerids analyzed.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (159.34 kb)

Abstract

Keywords

﻿1. Introduction

﻿2. Material and methods

﻿2.1. Collection, specimen preparation, and depositories

﻿2.2. Illustrations and terminology

﻿2.3. DNA extraction, amplification, sequencing, and alignment

﻿2.4. Species delimitation and phylogenetic analyses

﻿3. Results

﻿3.1. Phylogenetic relationships

﻿3.2. Taxonomy

﻿3.2.1. Triplectides gracilis (Burmeister, 1839)

Material examined.

Description.

Distribution.

Remarks.

﻿3.2.2. Triplectides bandeira sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿3.2.3. Triplectides caparaoensis sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿3.2.4. Triplectides cerradoensis sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿3.2.5. Triplectides iguassu sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿3.2.6. Triplectides mantiqueira sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿3.2.7. Triplectides paragracilis sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿ ﻿3.2.8. Triplectides puri sp. nov.

Type material.

Description.

Etymology.

Distribution.

Habitat.

Remarks.

﻿3.2.9. Triplectides cipo Henriques-Oliveira & Dumas, 2015

Material examined.

Description.

Distribution.

Habitat.

Remarks.

﻿3.2.10. Triplectides ultimus Holzenthal, 1988

Material examined.

Description.

Distribution.

Habitat.

Remarks.

﻿3.3. New records of Brazilian Triplectides

﻿3.3.1. Triplectides cipo Henriques-Oliveira & Dumas, 2015

Material examined.

1. Introduction

2. Material and methods

2.1. Collection, specimen preparation, and depositories

2.2. Illustrations and terminology

2.3. DNA extraction, amplification, sequencing, and alignment

2.4. Species delimitation and phylogenetic analyses

3. Results

3.1. Phylogenetic relationships

3.2. Taxonomy

3.2.1. Triplectides gracilis (Burmeister, 1839)

3.2.2. Triplectides bandeira sp. nov.

3.2.3. Triplectides caparaoensis sp. nov.

3.2.4. Triplectides cerradoensis sp. nov.

3.2.5. Triplectides iguassu sp. nov.

3.2.6. Triplectides mantiqueira sp. nov.

3.2.7. Triplectides paragracilis sp. nov.

3.2.8. Triplectides puri sp. nov.

3.2.9. Triplectides cipo Henriques-Oliveira & Dumas, 2015

3.2.10. Triplectides ultimus Holzenthal, 1988

3.3. New records of Brazilian Triplectides

3.3.1. Triplectides cipo Henriques-Oliveira & Dumas, 2015

3.3.2. Triplectides flintorum Holzenthal, 1988

3.3.3. Triplectides maranhensis Desiderio, Barcelos-Silva & Pes, 2017

4. Discussion

5. Acknowledgements

6. References