Research Article
Print
Research Article
Comparative morphology and evolutionary implications of larval mouthparts in ten lineages of Scarabaeoidea (Coleoptera)
expand article infoWen-Jun Cao‡, Lu Jiang‡
‡ Insect Museum, College of Plant Protection, Shenyang Agricultural University, Shenyang, China

Corresponding author: Lu Jiang ( jianglu@syau.edu.cn )

Academic editor: Michael Schmitt
© 2026 Wen-Jun Cao, Lu Jiang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
ZooBank: urn:lsid:zoobank.org:pub:2C2BF5D4-E72C-4BD0-883A-984253F7DA03
Open Access

Abstract

Larvae of the megadiverse Scarabaeoidea play important economic and ecological roles, and their mouthparts provide valuable morphological clues for species identification and dietary inference. However, the underlying relationships between morphological characters and feeding habits remain insufficiently elucidated. In this study, the larval mouthparts of 22 species representing ten major lineages of Scarabaeoidea were examined in detail. Seventeen characters of the larval mouthparts were analyzed within a phylogenetic framework. Three characters were identified as candidate synapomorphies for the major lineages represented here: maxillary stridulatory teeth for Scarabaeidae, mandibular stridulatory ridges for Cetoniinae + (Dynastinae + Rutelinae), and a circular arrangement of epipharyngeal phobae for Aphodiinae + Scarabaeinae. By contrast, several homoplastic mouthpart traits were recurrently associated with larval feeding habits in the sampled taxa, including a setose acroparia, heli on the epipharynx, and a blade-like incisor region in phytophagous lineages, and the circular phoba complex together with the absence of nesium in coprophagous lineages. These results suggest that larval mouthparts in Scarabaeoidea may retain both phylogenetic and trophic signals, providing a morphological basis for interpreting the evolution of feeding habits in scarab larvae.

Keywords

white grubs, epipharynx, maxillae, larvae, systematics

1. Introduction

Scarabaeoidea constitute one of the most speciose radiations of Coleoptera, comprising approximately 35,000 described species distributed across 13 families (Browne and Scholtz 2002; Ahrens et al. 2014; Scholtz and Grebennikov 2016). Despite extensive taxonomic work on adults, the larval stages of many lineages remain insufficiently documented. This gap is striking given the ecological importance of scarabaeoid larvae, which occupy a wide range of trophic niches—including saproxylic (Huang 2018; Ulyshen 2018), saprophagous (Micó and Galante 2003; Rodrigues et al. 2018), coprophagous (Cabrero-Sañudo and Zardoya 2004; Scholtz et al. 2009), and phytophagous (Zhang 1984; Ansari et al. 2006; Harrison and Wingfield 2016; Long et al. 2024). These diverse dietary modes contribute substantially to ecosystem functioning, such as organic matter turnover (Nichols et al. 2008; Doube 2018), but also include species of major agricultural concern due to their feeding on subterranean plant organs (Cave and Ratcliffe 2008; Chen et al. 2025).

Mouthparts, which mediate food acquisition and processing, represent one of the most functionally and phylogenetically informative components of larval morphology (Blanke et al. 2015; Krenn 2019). Although most insect larvae possess generalized chewing-type mouthparts (Stehr 1987; Angelini and Smith 2019), substantial variation in structure is evident among scarabaeoid lineages. Historically, these characters have played important roles in larval taxonomy and identification (Hayes 1928, 1929; Böving 1942; Medvedev 1952; Ritcher 1966; Zhang 1984; Sawada 1991), and contemporary studies continue to underscore their relevance for understanding lineage differentiation (Šípek 2010; Sousa et al. 2018). Yet fewer than 2% of insect larvae have been formally described (Lawrence et al. 2011; Šípek and Král, 2012), leaving the breadth of larval mouthpart diversity, particularly in Scarabaeoidea, far from comprehensively documented.

A persistent challenge in interpreting mouthpart morphology lies in disentangling homology from homoplasy. Recent studies have revealed that morphologically similar structures may evolve independently in unrelated scarabaeoid groups (Jia et al. 2021; Zhang et al. 2024), while considerable structural divergence can occur within closely related clades (Fang et al. 2018; Sun et al. 2024). Such patterns imply that convergent evolution may be widespread, likely driven by dietary transitions or shifts in ecological niche. Without a phylogenetic context, it remains difficult to ascertain whether a character state reflects shared ancestry (synapomorphy) or is the result of convergent or parallel evolution (homoplasy). Consequently, systematic and phylogenetically informed comparative analyses are essential for clarifying the evolutionary origins of larval mouthpart traits across Scarabaeoidea.

To address these gaps, the present study provides detailed examinations of third-instar larval mouthparts for ten species representing major lineages of Scarabaeoidea, supplemented by twelve additional species for which both morphological descriptions and mitochondrial genomes are available. In total, seventeen mouthpart characters were analyzed within a phylogenetic framework to evaluate their evolutionary polarity and homology. Specifically, we aimed to identify mouthpart characters that may represent candidate synapomorphies, clarify the distribution of homoplastic traits across lineages, and assess how specific morphological features relate to larval feeding habits. These analyses yield new insights into the evolutionary diversification of scarabaeoid larval mouthparts and provide a comparative framework for studies of insect functional morphology and character evolution.

2. Materials and methods

2.1. Selection of taxa

The larval mouthparts of ten scarabaeoid species were described for the first time in this study. Together with twelve species whose mouthparts have been previously described and whose mitochondrial genomes are available in GenBank, we constructed a phylogenetic tree to investigate evolutionary patterns in larval mouthpart morphology. Detailed sample information is provided in Table 1 and Table SS1.

Table 1.
Download as
CSV
XLSX

Mitogenomic data and corresponding references for third-instar larval mouthparts of 23 scarabaeoid species.

Family Subfamily Tribe Species Accession (mtGenomes) Morphological references
Hydrophilidae Hydrophilinae Hydrophilini Sternolophus rufipes OQ029525 (Minoshima and Hayashi 2011)
Passalidae Passalinae Passalini Ophrygonlus sp. NC_060602 /
Lucanidae Lucaninae Dorcini Dorcus parallelipipedus KT876887 (Grebennikov and Scholtz 2004, Šípek 2010)
Lucanidae Lucaninae Lucanini Lucanus dybowski This study /
Lucanidae Syndesinae Sinodendrini Sinodendron rugosum MH120284 (Hayes 1928, Ritcher 1966)
Scarabaeidae Scarabaeinae Onthophagini Onthophagus fodiens This study /
Scarabaeidae Aphodiinae Aphodiini Aphodius elegans This study /
Scarabaeidae Sericinae Sericini Maladera orientalis This study (Šípek and Ahrens 2011, Cao et al. 2024)
Scarabaeidae Sericinae Sericini Serica brunnea MT872683 (Šípek and Ahrens 2011)
Scarabaeidae Euchirinae Euchirini Propomacrus bimucronatus NC_070352 (Šípek 2010)
Scarabaeidae Melolonthinae Melolonthini Melolontha hippocastani KX087316 (Zhang 1984)
Scarabaeidae Melolonthinae Rhizotrogini Miridiba trichophora NC_068084 (Zhang et al. 2024)
Scarabaeidae Melolonthinae Rhizotrogini Nigrotrichia gebleri MT548775 (Zhang 1984)
Scarabaeidae Cetoniinae Cetoniini Glycyphana fulvistemma NC_063847 (Zhang 1984)
Scarabaeidae Cetoniinae Cetoniini Protaetia brevitarsis KC775706 (Zhang 1984)
Scarabaeidae Dynastinae Phileurini Eophileurus chinensis MW632132 (Jiang et al. 2025)
Scarabaeidae Dynastinae Oryctini Oryctes rhinoceros MT457815 (Zhang 1984)
Scarabaeidae Dynastinae Dynastini Trypoxylus dichotomus This study (Zhang 1984)
Scarabaeidae Rutelinae Anomalini Anomala corpulenta NC_069575 (Zhang 1984)
Scarabaeidae Rutelinae Anomalini Callistethus plagiicollis NC_082144 (Long et al. 2024)
Scarabaeidae Rutelinae Anomalini Mimela splendens MT548770 (Zhang 1984)
Scarabaeidae Rutelinae Anomalini Popillia japonica NC_038115 (Hayes 1928, Ritcher 1966)
Scarabaeidae Rutelinae Anomalini Popillia mutans NC_056126 (Zhang 1984)

2.2. Insect collection, rearing and identification

Collection data and rearing methods are summarized in Table 2. Adults were reared individually in plastic boxes covered with gauze under natural conditions. Each box contained a 4–5 cm layer of moist soil to allow females to deposit eggs. Uncertain passalid adults were identified using COI sequences (Elyasigorji et al. 2023). Larvae were reared following Ritcher (1966) and Zhang (1984).

Table 2.
Download as
CSV
XLSX

Ten sample information of larvae and adults in Scarabaeoidea.

Family/subfamily Species Localities Dates Adult feed Larval feed
Lucanidae Lucanus dybowski Liaoning province, Huabo Mountain, 41°10'N, 125°05'E, vii-16-2020 vii-16-2020 banana fermented sawdust
Passalidae Ophrygonlus sp. Yunnan province, Xima Town, 25°96'N, 100°13'E ix-28-2018 rotten wood rotten wood
Scarabaeinae Onthophagus fodiens Liaoning province, Dongling District, 39°91'N, 116°41'E x-4-2023 cow dung cow dung
Aphodiinae Aphodius elegans Henan province, Jingziguan Town, 33°24'N, 111°03'E v-22-2022 cow dung cow dung
Sericinae Maladera orientalis Liaoning province, Dongling District, 39°91'N, 116°41'E x-16-2023 elm leaves root of wheat
Euchirinae Propomacrus bimucronatus Purchased from an online pet shop v-9-2018 banana fermented sawdust
Melolonthinae Nigrotrichia gebleri Liaoning province, Dongling District, 39°91'N, 116°41E vii-15-2023 elm leaves root of wheat
Cetoniinae Protaetia brevitarsis Liaoning province, Dongling District, 39°91'N, 116°41'E vii-20-2020 banana fermented sawdust
Rutelinae Anomala corpulenta Liaoning province, Chengzishan Forest Park, 41°13'N, 119°08'E viii-3-2020 elm leaves root of wheat
Dynastinae Trypoxylus dichotomus Liaoning province, Huabo Mountain, 41°10'N, 125°05'E vii-15-2023 banana fermented sawdust

2.3. Light and scanning electron microscopy

For morphological comparisons, at least ten larvae of each species were fixed in Dietrich’s solution (formalin: 95% ethanol: glacial acetic acid: distilled water = 6:15:1:80, v/v), heated to 70 °C, and left to stand for 12 h under a fume hood before being preserved in 75% ethanol (Jiang and Hua 2015). Photographs were taken with a Nikon D810 digital camera (Nikon Corporation, Tokyo, Japan), and draft drawings were refined using Adobe Photoshop CS4.

For scanning electron microscopy (SEM), more than ten specimens of each species were examined to exclude individual variation. Larvae were dissected in 70% ethanol under a Leica EZ4HD stereoscopic microscope, ultrasonically cleaned for two minutes, and rinsed twice in 70% ethanol. Dissected organs were dehydrated in a graded ethanol series, replaced with tert-butanol, freeze-dried for 3 h, sputter-coated with gold, and examined using a Hitachi S-3400N SEM (Hitachi, Tokyo, Japan) at 5 kV. Larval morphological terminology follows Böving (1936), Ritcher (1966), and Lawrence (1991).

2.4. DNA extraction amplification, and sequencing

DNA was extracted from thoracic muscle tissue or legs using the TIANamp Genomic DNA Kit (Tiangen Biotech, Shanghai, China) following the manufacturer’s instructions. COI fragments were amplified by PCR using primers C1-J-2441 (CCAACAGGAATTAAAATTTTTAGATGATTAGC) and TL2-N-3014 (TCCAATGCACTAATCTGCCATATTA) (Beza-Beza et al. 2017). Each 20 µl reaction contained 10 µl 2× Taq Master Mix (Dye Plus; Vazyme Biotech, China), 0.5 µl of each primer, 2 µl template DNA, and 7 µl ddH2O. PCR conditions were: 94 °C for 3 min; 30 cycles of 94 °C for 30 s, 47 °C for 1 min, and 68 °C for 1.5 min; followed by 72 °C for 10 min and storage at 4 °C. PCR products were sequenced by Sangon Biotech (Shanghai, China). Sequences were assembled and edited in Geneious R8.1 (Kearse et al. 2012) and are provided in Supplementary Materials, File S1. Field-collected specimens were preserved in 100% ethanol and stored at –40°C until DNA extraction. Voucher specimens are deposited at the College of Plant Protection, Shenyang Agricultural University, Shenyang, China.

2.5. Mitogenome DNA sequencing, assembling, annotation and analyses

DNA samples were sequenced on an Illumina NovaSeq 6000 platform at Nanjing Yanxin Biotechnology Company (Nanjing, China) and Sangon Biotech (Shanghai, China). Mitochondrial genomes were assembled using MitoZ v2.3 (Meng et al. 2019) and Idba-Ud v1.1.3 (Peng et al. 2012). Preliminary annotations were generated using MITOS (Bernt et al. 2013) with the invertebrate mitochondrial code and subsequently corrected in Geneious R8.1 (Kearse et al. 2012). Reference sequences used for annotation included Lucanus dybowski (Lucanidae: MK878514), Onthophagus fodiens (Scarabaeinae: KU739496), Aphodius elegans (Aphodiinae: NC045923), Maladera orientalis (Sericinae: MT872683), and Trypoxylus dichotomus (Dynastinae: OK484314). Five newly generated mitochondrial genomes were deposited in NCBI under accession numbers PQ067330–PQ067331 and PQ083081–PQ083083 (Table 1).

2.6. Phylogenetic analysis

We used mitochondrial genes from 23 species, excluding the control region, intergenic spacers, and 22 tRNA genes, and including 13 protein-coding genes (PCGs) and two rRNA genes. Sequences were obtained from GenBank (including the five newly sequenced genomes). Outgroup taxa were selected following Ahrens et al. (2014).

Sequences were aligned using MAFFT v7.505 (Katoh and Standley 2013) with the “--auto” strategy, and PCGs were refined using MACSE v2.06 (Ranwez et al. 2018) to preserve reading frames. Alignments were trimmed with trimAl v1.2rev57 using the “-nogaps” option (Capella-Gutiérrez et al. 2009).

Maximum Likelihood (ML) analyses were conducted in IQ-TREE v2.2.0 (Nguyen et al. 2015) with the best-fit partitioning scheme selected by ModelFinder (Kalyaanamoorthy et al. 2017) under the AIC. Node support was assessed using 5000 ultrafast bootstrap replicates (Minh et al. 2013) and 1000 SH-like approximate likelihood ratio tests (Guindon et al. 2010).

Bayesian inference (BI) analyses were performed using MrBayes v3.2.7 (Ronquist et al. 2012) under a partitioned model (two parallel runs, 1,000,000 generations), discarding the first 25% of samples as burn-in. PartitionFinder2 v2.1.1 (Lanfear et al. 2017) was used to select the optimal partitioning scheme and evolutionary models using the greedy algorithm and BIC. Phylogenetic trees were viewed and edited in FigTree v1.4.4 (Rambaut 2018).

Five datasets were analyzed: 13PCGs, 13PCGs12, 13PCGsAA, 13PCGs12 + 2rRNA (PCGs12rRNA), and 13PCGs + 2rRNA (PCGs2rRNA). All sequences were extracted, aligned, trimmed, concatenated, and analyzed using PhyloSuite v1.2.3 (Zhang et al. 2020; Xiang et al. 2023). All phylogenetic data are provided in Files S2–S4.

2.7. Ancestral characteristic reconstruction

Seventeen larval mouthpart characters were reconstructed using Mesquite v2.75 (Maddison and Maddison 2011). Outgroup character states followed Minoshima and Hayashi (2011). Results were exported as PDF files and organized using Adobe Photoshop 2020. Each character state was mapped onto the ML tree based on the PCGs2rRNA dataset (Likelihood Ancestral States). All character data are provided in Table SS2 and File S5.

3. Results

3.1. General morphology of the ten larval mouthparts

The larval mouthparts represent the typical biting–chewing type and consist of a labrum, paired mandibles, and a maxilla–labium–hypopharynx complex. The epipharynx is generally fan-shaped or tri-lobed and includes a distinct haptomerum, paired pariae, a median pedium, and a proximal haptolachus. The corypha forms a weakly to moderately arched transverse margin bearing a row of setae.

The paria is differentiated into the acanthoparia, gymnoparia, chaetoparia, and acroparia, sometimes associated with plegmatium, proplegmatium, and phobae. The acanthoparia typically bears a row of spine-like to needle-like setae decreasing in size posteriorly. The gymnoparia is consistently present and usually narrow. The chaetoparia is well developed and densely setose, although the number of setae varies markedly among species. The haptolachus bears one to three nesia depending on species.

Mandibles are heavily sclerotized and distinctly asymmetrical, with a well-defined apical incisor region and a basal molar region. The precoila is shallowly notched, and the postcoila is knob-like. The ventral molar surface is generally smooth to weakly sculptured. The lateral ventral region bears brustia that are variably developed, ranging from absent to distinctly tufted. The dorsal and lateral mandibular surfaces bear scattered setae of variable density. The left molar tooth in several taxa bears a triangular to blunt acia.

Each maxilla consists of the cardo, stipes, galea, and lacinia separate or fused into the mala, and a palp of two to four segments. The dorsal surface of the stipes usually bears a row of stridulatory teeth (when present, 5–22 teeth), occasionally accompanied by an additional process. The labium is composed of the submentum, mentum, and prementum, and bears paired two-segmented labial palps (Figs 1, 2, 3, 4, 5, 6, 7, 8, 9, 10).

3.1.1. Lucanus dybowski Parry, 1873

The epipharynx is distinctly fan-shaped, with a smooth haptomerum that lacks heli. The corypha is weakly arched and bears seven setae (Fig. 1A). The haptomerum carries 13 setae arranged in a curved row (Fig. 1B). The chaetoparia is well developed and densely setose, whereas the gymnoparia is relatively narrow but distinct. The pedium is concave and glabrous, and the acroparia is devoid of setae. Phobae, the plegmatium, and the proplegmatium are absent. The haptolachus bears three sclerotized nesia (Fig. 1A).

Figure 1. 

Mouthparts of Lucanus dybowski Parry, 1873. A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H maxillae and labia, ventral. — Acp, acanthoparia; Acr, acroparia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; M, mola; MP, maxillary palp; N1–3, nesium; Pe, pedium; S1–4, scissorial tooth; Sp, stipes; VP, ventral protuberance.

Mandibles are distinctly asymmetrical. The left mandible bears three apical and two medial incisor teeth (Fig. 1C), whereas the right mandible bears two apical and one medial tooth (Fig. 1D). The right molar region forms a large ventral protuberance with three small teeth (Fig. 1E), while the left mandible possesses a prominent molar tooth accompanied by a small ventral protuberance (Fig. 1F). The ventral molar region is smooth and lacks lateral brustia. The stridulatory area is glabrous, and the acia is absent (Fig. 1E, F).

The maxilla has the galea and lacinia clearly separated and bears a four-segmented palp. Maxillary stridulatory teeth and additional processes are absent (Fig. 1G, H).

3.1.2. Ophrygonlus sp.

The epipharynx is distinctly fan-shaped, with a smooth haptomerum that lacks heli. The corypha is moderately arched and bears five setae arranged posteriorly (Fig. 2A). The haptomerum carries eight setae situated at the posterior margin (Fig. 2B). The chaetoparia is well developed and densely setose, whereas the gymnoparia is narrow but clearly defined. The pedium is equipped with 12 setae, and the acroparia is indistinct and apparently asetose. Phobae are absent. The haptolachus bears two well-developed nesia and lacks the medical nesium.

Figure 2. 

Mouthparts of Ophrygonlus sp. (A) Epipharynx; B incisor region of left mandible, dorsal; C incisor region of left mandible, dorsal; D left mandible, dorsal; E right mandible, dorsal; F right mandible, ventral; G left mandible, ventral; H maxillae, labium, and hypopharynx, dorsal; I stipes. — Acp, acanthoparia; Acr, acroparia; Br: brustia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; M, mola; McP, micro protuberances; MP, maxillary palp; N1–2, nesium; Pe, pedium; S1–3, scissorial tooth; Sp, stipes.

The mandibles are moderately symmetrical. The mandible bears three incisors and one molar tooth (Fig. 2B–G). The dorsal molar surface is smooth on both mandibles. The molar region forms a large ventral protuberance accompanied by a concave molar tooth. Lateral brustia are present, and the stridulatory area is glabrous and indistinct. The acia is not developed (Fig. 2D–G).

The maxilla has a galea and lacinia that are nearly fused. The lacinia bears a spherical protuberance furnished with minute ventral setae. The palpus is three-segmented and elongated (Fig. 2G, H). Stridulatory teeth are absent, and additional cardo or stipes processes are not developed.

3.1.3. Onthophagus fodiens Waterhouse, 1875

The epipharynx is distinctly tri-lobed, with a smooth haptomerum that lacks heli. The corypha bears four setae positioned near the posterior margin (Fig. 3A). The chaetoparia is moderately developed and setose, whereas the gymnoparia is narrow but distinct. The pedium is smooth and glabrous, and the acroparia is indistinct. Phobae are present. The haptolachus is well developed without nesia.

Figure 3. 

Mouthparts of Onthophagus fodiens Waterhouse, 1875. A Epipharynx; B Protophobae; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory teeth. — Acp, acanthoparia; Acr, acroparia; Br: brustia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Dph, dexiophoba; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; Lph, laeophoba; M, mola; MP, maxillary palp; Mph, mesophaba; Pe, pedium; Pph, protophoba; S1–3, scissorial tooth; Sp, stipes; ST, stridulatory teeth; VP, ventral protuberance.

The mandibles exhibit slight asymmetry. The left mandible bears three incisors and one molar teeth (Fig. 3C), whereas the right mandible bears two incisors and one molar teeth (Fig. 3D). The dorsal molar area is smooth on both mandibles. The right molar region forms a large ventral protuberance together with a minute inner tooth (Fig. 3E), whereas the left molar region possesses a more robust tooth accompanied by a small ventral protuberance (Fig. 3F). Lateral brustia are present, and the stridulatory area is glabrous. The acia is undeveloped on both mandibles.

The maxilla has the galea and lacinia nearly fused, and the lacinia bears a single strong tooth. The palpus is elongate and four-segmented (Fig. 3G, H). Maxillary stridulatory teeth are present, and anterior processes are absent.

3.1.4. Aphodius elegans Allibert, 1847

The epipharynx is fan-shaped, with a smooth haptomerum that lacks helus. The corypha is weakly arched and bears four setae. The chaetoparia is sparsely setose to nearly smooth, whereas the gymnoparia is broad. The pedium is concave, glabrous, and is surrounded by a complete ring of phobae, including two rows of protophobae together with laeophoba, dexiphoba, and mesophoba; the second row of protophobae is relatively longer and situated on the right side (Fig. 4B). The acroparia is glabrous, and the plegmatium, proplegmatium, and nesia are absent (Fig. 4A).

Figure 4. 

Mouthparts of Aphodius elegans Allibert, 1847. A Epipharynx; B Protophobae; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I Stridulatory teeth. — Acp, acanthoparia; Acr, acroparia; Br: brustia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Dph, dexiophoba; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; Lph, laeophoba; M, mola; MP, maxillary palp; Mph, mesophaba; Pe, pedium; Pph, protophoba; S1–3, scissorial tooth; SN, scissorial notch; Sp, stipes; ST, stridulatory teeth; StA, stridulatory area; VP, ventral protuberance.

The mandibles are distinctly asymmetrical. The incisors are blunt and triangular, consisting of a larger curved apical tooth (I), a reduced tooth (II), and a smaller distal tooth (III) beyond the incisor notch (Fig. 4C–F). The right molar region bears a blunt molar tooth with a large ventral protuberance, whereas the left mandible possesses a prominent molar tooth accompanied by a small ventral protuberance. The ventral molar surface is smooth but weakly ridged and bears paired tufted brustia laterally. The stridulatory area is glabrous, and the acia is absent (Fig. 4E, F, H).

The maxilla has the galea and lacinia clearly separated and bears a four-segmented palp (Fig. 4G). Each stipes bears 11 or 12 stridulatory teeth without additional processes (Fig. 4G, I).

3.1.5. Maladera orientalis (Motschulsky, 1857)

The epipharynx is distinctly fan-shaped and bears a protuberant haptomerum with three heli. The corypha is swollen and carries seven setae. The chaetoparia is well developed and densely setose, and the acroparia bears long bristles. The gymnoparia is narrow but clearly defined. The plegmatium is composed of 18 or 19 short, nearly parallel plegmata, and the pedium is concave and glabrous. The haptolachus bears two nesia and lacks the right nesium. Both proplegmatium and phobae are absent (Fig. 5A, B).

Figure 5. 

Mouthparts of Maladera orientalis (Motschulsky, 1857). A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I stridulatory teeth. — Ac, acia; Acr, acroparia; Acp, acanthoparia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; H, helus; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; M, mola; MP, maxillary palp; N1–2, nesium; Pe, pedium; Pl, Plegmatium; S1–3, scissorial tooth; SN, scissorial notch; ScR, sclerotized ridge; Sp, stipes; ST, stridulatory teeth; SR, stridulatory ridge; VP, ventral protuberance.

The mandibles are asymmetrical. The incisors are sharply blade-like, each bearing a large apical tooth (I), a reduced secondary tooth (II), and a smaller tertiary tooth (III) beyond the incisor notch (Fig. 5C–F). The right molar region forms a large ventral protuberance armed with three small teeth (Fig. 5E), whereas the left mandible bears a prominent molar tooth accompanied by a small ventral protuberance (Fig. 5F). The ventral molar surface is smooth and lacks lateral brustia. The stridulatory area is glabrous but provided with an additional sclerotized ridge. The acia is bluntly triangular (Fig. 5E, F, H).

The maxilla bears a four-segmented palp and has the galea and lacinia fused (Fig. 5G). Each stipes carries 21 or 22 comb-like stridulatory teeth and lacks additional processes (Fig. 5G, I).

3.1.6. Nigrotrichia gebleri (Faldermann, 1835)

The epipharynx is fan-shaped and bears a protuberant haptomerum with nine heli and six minute sensilla (Fig. 6B). The corypha is weakly arched and bears six setae. The chaetoparia is well developed and densely setose, and the acroparia carries long bristles. The gymnoparia is narrow but distinct. The pedium is concave and glabrous. The plegmatium comprises 14 or 15 short, nearly parallel plegmata, and each proplegmatium consists of seven prominent ridges. The haptolachus bears phobae and two nesia and lacks the right nesium (Fig. 6A, B).

Figure 6. 

Mouthparts of Nigrotrichia gebleri (Faldermann, 1835). A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I stridulatory teeth. — Ac, acia; Acr, acroparia; Acp, acanthoparia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; H, helus; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; M, mola; MP, maxillary palp; MS, minute sensillum; N1–2, nesium; Pe, pedium; Ph, phoba; Pl, Plegmatium; Prl, proplegmatium; S1–3, scissorial tooth; SN, scissorial notch; Sp, stipes; ST, stridulatory teeth; StA, stridulatory area; VP, ventral protuberance.

The mandibles are distinctly asymmetrical. The incisors are sharply blade-like, each bearing a large pointed apical tooth (I), a reduced tooth (II), and a smaller tooth (III) posterior to the incisor notch (Fig. 6C–F). The right molar region forms a large ventral protuberance with four small teeth (Fig. 6E), where the left mandible bears a prominent molar tooth together with a small ventral protuberance (Fig. 6F). The ventral molar region is smooth and lacks lateral brustia. The stridulatory area is coarse in texture, and the acia is bluntly oval (Fig. 6E, F, H).

The maxilla has a four-segmented palp and has the galea and lacinia fused. Each stipes is armed with 13–15 small, acute stridulatory teeth and lacks additional processes (Fig. 6G, I).

3.1.7. Propomacrus bimucronatus (Pallas, 1781)

The epipharynx is fan-shaped, with a smooth haptomerum that lacks helus. The corypha is weakly arched and bears eight setae (Fig. 7B). The haptomerum bears three asymmetric rows of obliquely arranged setae. The chaetoparia is well developed and densely setose, whereas the gymnoparia is narrow but distinct. The proplegmatium is strongly wave-like and consists of 25–28 ridges, whereas the plegmatium comprises 17 or 18 short, nearly parallel plegmata. The pedium is concave and glabrous. The haptolachus bears a medial nesium, with the outer nesia absent. The acroparia is glabrous, and phobae are absent (Fig. 7A).

Figure 7. 

Mouthparts of Propomacrus bimucronatus (Pallas, 1781). A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I stridulatory teeth. — Acp, acanthoparia; Acr, acroparia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; M, mola; MP, maxillary palp; N, nesium; Pe, pedium; Pl, Plegmatium; Prl, proplegmatium; S1–2, scissorial tooth; Sp, stipes; ST, stridulatory teeth; StA, stridulatory area; VP, ventral protuberance.

The mandibles are distinctly asymmetrical. Each incisor bears two sharply pointed scissorial teeth (Fig. 7C–F). The molar region includes a small ventral protuberance on each side, with four small molar teeth on the right mandible and a single prominent molar tooth on the left. The ventral molar surface is smooth and lacks lateral brustia. The stridulatory area is glabrous and the acia is absent (Fig. 7C–F, H).

The maxilla bears a four-segmented palp and has galea and lacinia fused (Fig. 7G). Each stipes bears 8 or 9 stridulatory teeth and lacks additional processes (Fig. 7I).

3.1.8. Protaetia brevitarsis (Lewis, 1879)

The epipharynx is distinctly tri-lobed, with a smooth haptomerum that lacks helus. The corypha is slightly arched with six setae. The haptomerum bears 22 setae arranged in a curved arc together with an additional irregular cluster of 10 setae (Fig. 8B). The chaetoparia is well developed and densely setose, whereas the gymnoparia is narrow but clearly defined. The pedium is concave and glabrous. The haptolachus bears a medial nesium, with outer nesia absent. The acroparia is glabrous, and phobae, the plegmatium, and the proplegmatium are absent (Fig. 8A).

Figure 8. 

Mouthparts of Protaetia brevitarsis (Lewis, 1879). A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I Stridulatory teeth. — Acp, acanthoparia; Acr, acroparia; AP, additional process; Br: brustia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; M, mola; MP, maxillary palp; N, nesium; Pe, pedium; S1–4, scissorial tooth; Sp, stipes; SR, stridulatory ridge; ST, stridulatory teeth; StA, stridulatory area; VP, ventral protuberance.

The mandibles are distinctly asymmetrical. The left mandible bears four scissorial teeth (Fig. 8C), whereas the right mandible bears three (Fig. 8D). The right molar region forms a large ventral protuberance armed with three small teeth (Fig. 8E), while the left mandible bears a prominent molar tooth accompanied by a small ventral protuberance (Fig. 8F). The ventral molar region is smooth and bears a tufted brustia laterally. The stridulatory area is narrow and oval and provided with distinct transverse ridges. The acia is absent (Fig. 8C–F, H).

The maxilla bears a four-segmented palp and has the mala formed by fused galea and lacinia (Fig. 8G). Each stipes bears seven acute stridulatory teeth and is additionally provided with a globose accessory process (Fig. 8G, I).

3.1.9. Anomala corpulenta Motschulsky, 1854

The epipharynx is fan-shaped and bears a protuberant haptomerum bearing three heli and six minute sensilla (Fig. 9B). The corypha is weakly arched and bears ten setae. The chaetoparia is well developed and densely setose, and the acroparia bears long bristles. The gymnoparia is narrow but distinct. The plegmatium consists of 21–23 short, nearly parallel plegmata. The pedium is concave and glabrous. The haptolachus bears two nesia and lacks the right nesium. The proplegmatium and phobae are absent (Fig. 9A).

Figure 9. 

Mouthparts of Anomala corpulenta Motschulsky, 1854. A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G Maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I stridulatory teeth. — Ac, acia; Acr, acroparia; Acp, acanthoparia; AP, additional process; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; H, helus; Hm, haptomerum; In, incisor; La, lacinia; M, mola; MP, maxillary palp; MS, minute sensillum; N1–2, nesium; Pe, pedium; Pl, Plegmatium; S1–3, scissorial tooth; SN, scissorial notch; Sp, stipes; SR, stridulatory ridge; ST, stridulatory teeth; StA, stridulatory area; VP, ventral protuberance.

The mandibles are distinctly asymmetrical. Each incisor is blade-like and bears a sharply pointed apical tooth (I), a reduced tooth (II), and a smaller tooth (III) distal to the incisor notch (Fig. 9C–F). The right molar region forms a large ventral protuberance with four small teeth (Fig. 9E), whereas the left molar region bears a prominent molar tooth together with a small ventral protuberance (Fig. 9F). The ventral molar surface is smooth and lacks lateral brustia. The stridulatory area is broadly oval and provided with distinct transverse ridges. The acia is bluntly triangular (Fig. 9C–F, H).

The maxilla bears a four-segmented palp and has the mala formed by fused galea and lacinia. Each stipes carries seven acute stridulatory teeth and is additionally provided with a truncate accessory process (Fig. 9G, I).

3.1.10. Trypoxylus dichotomus (Linnaeus, 1771)

The epipharynx is fan-shaped, with a smooth haptomerum that lacks helus. The corypha is weakly arched and bears six setae. The haptomerum bears a sclerotized acute process accompanied by five minute sensilla (Fig. 10B). The chaetoparia is well developed and densely setose, whereas the gymnoparia is narrow but distinct. The pedium is concave and glabrous. The haptolachus bears two nesia and lacks the right nesium. The acroparia is glabrous, and phobae, the plegmatium, and the proplegmatium are absent (Fig. 10A).

Figure 10. 

Mouthparts of Trypoxylus dichotomus (Linnaeus, 1771). A Epipharynx; B Haptomerum; C left mandible, dorsal; D right mandible, dorsal; E right mandible, ventral; F left mandible, ventral; G maxillae, labium, and hypopharynx, dorsal; H stridulatory area; I stridulatory teeth. — Ac, acia; Acp, acanthoparia; Acr, acroparia; AP, additional process; Br: brustia; Ca, cardo; Co, corypha; Cpa, chaetoparia; Ga, galea; Gp, gymnoparia; Hm, haptomerum; In, incisor; La, lacinia; LP, labial palp; M, mola; MP, maxillary palp; MS, minute sensillum; N1–2, nesium; Pe, pedium; S1–4, scissorial tooth; Sp, stipes; SR, stridulatory ridge; ST, stridulatory teeth; StA, stridulatory area; VP, ventral protuberance.

The mandibles are asymmetrical. The mandible bears two apical and two medial scissorial teeth (Fig. 10C–F). The right molar region includes three small molar teeth together with a large ventral protuberance (Fig. 10D), whereas the left mandible bears a large molar tooth accompanied by a small ventral protuberance (Fig. 10F). The ventral molar region is smooth and carries three tufted brustia laterally. The stridulatory area is narrow and oval and furnished with dense transverse ridges. The acia is sharply triangular (Fig. 10C–F, H).

The maxilla bears a four-segmented palp and has the mala formed by fused galea and lacinia. Each stipes bears 5–11 blunt stridulatory teeth and is additionally provided with a blunt accessory process (Fig. 10G–I).

3.2. Phylogenetic analysis

Bayesian inference and Maximum Likelihood analyses produced highly congruent topologies across all five datasets (13PCGs, 13PCGs12, 13PCGsAA, PCGs2rRNA and PCGs12rRNA) (Fig. 11; File S4). Among these, the PCGs2rRNA dataset yielded the highest overall nodal support and was therefore adopted for subsequent evolutionary analyses. The resulting phylogeny consistently placed Lucanidae as the sister lineage to all remaining scarab beetles (Clade A; BPP = 1), followed by Passalidae as sister to the rest of Scarabaeoidea (Clade B; UFBoot = 96.2, SH-aLRT = 94, BPP = 0.91). The monophyly of Scarabaeoidea received full Bayesian support (BPP = 1).

Figure 11. 

Phylogenetic relationships of Scarabaeoidea based on PCGs2rRNA dataset (13PCGs + 2rRNA) and reconstruct ancestral characteristics of twenty-two larval mouthparts of Scarabaeoidea. Support values for branches of maximum likelihood ultrafast bootstrap (UFBoot) and SH-like approximate likelihood ratio test (SH-aLRT), and Bayesian posterior probabilities (BPP) in terms of the support values for branches were marked at all nodes in sequence. * represent synapomorphy. SE, shape of epipharynx tri-lobed (0: absent, 1: present); Acr, acroparia with long setae (0: absent, 1: present); H, helus (0: absent, 1: present); Gp, gymnoparia longer than or equal to one quarter of the width of epipharynx (0: absent, 1: present); Pl, plegmatium (0: absent, 1: present); Prl, proplegmatium (0: absent, 1: present); Ph, phobae (0: absent, 1: present); Cph, circular phoba arrangement (0: absent, 1: present); Pe, pedium (0: glabrous, 1:setiferous ); N, nesium (0: absent, 1: present); Mb, Mandibles (0: symmetric, 1: asymmetric); In, incisors (0: dentate, 1: blade-like); Ac, acia (0: absent, 1: present); SR, stridulatory ridges (0: absent, 1: present); GL, galea and lacinia (0: fused, 1: separated); ST, stridulatory teeth (0: absent, 1: present); MP, maxillary palp (0: two to three-segmented, 1: four-segmented).

Within Scarabaeidae (Clade D; UFBoot = 91.5, SH-aLRT = 89, BPP = 1), two major lineages were well resolved. The coprophagous clade comprising Aphodiinae and Scarabaeinae (Clade E; UFBoot = 100, SH-aLRT = 97, BPP = 1) formed a robust sister group to the phytophagous assemblage containing Sericinae, Melolonthinae, Euchirinae, Cetoniinae, Rutelinae and Dynastinae (Clade F). Within this latter group, Sericinae was consistently inferred as the sister lineage to all other phytophagous subfamilies (UFBoot = 99.8, SH-aLRT = 100, BPP = 1). Melolonthinae, in turn, emerged as the sister group to a clade comprising Cetoniinae + (Dynastinae + Rutelinae), with strong Bayesian support (Clade K; BPP = 1). All included subfamilies of Scarabaeidae (Aphodiinae, Scarabaeinae, Sericinae, Melolonthinae, Cetoniinae, Rutelinae, Dynastinae) were recovered as monophyletic with maximal posterior probabilities (Fig. 11).

3.3. Reconstruct ancestral characteristics

Seventeen larval mouthpart characters from the epipharynx, mandibles and maxillae were reconstructed on the congruent BI/ML topology generated from the PCGs2rRNA dataset (Fig. 11). Three characters were consistently recovered as candidate synapomorphies within the sampled framework of major scarab lineages. Mandibular stridulatory ridges were inferred as a derived condition characterizing Clade M (Cetoniinae, Dynastinae and Rutelinae) in the taxa examined here. A circular arrangement of phobae, comprising protophoba, laeophoba, dexiphoba and mesophoba, was recovered as a putative synapomorphy of the sampled Aphodiinae + Scarabaeinae (Clade E). Maxillary stridulatory teeth were supported as a potential synapomorphy for Scarabaeidae in the sampled taxa (Clade D). In addition to these lineage-specific traits, a hirsute pedium and strongly asymmetric mandibles were inferred to be shared by all Scarabaeoidea excluding Passalidae.

Patterns associated with dietary evolution were also evident. Three characters—namely a setose acroparia, the presence of heli on the epipharynx, and a blade-like incisor region—were confined to the sampled phytophagous lineages in our dataset, including Sericinae, Melolonthinae and Rutelinae. These features appear to reflect common morphological adaptations to feeding on subterranean plant tissues.

Conversely, Aphodiinae and Scarabaeinae shared several distinctive modifications associated with coprophagy. The circular phoba complex on the epipharynx was restricted to these two lineages within the sampled taxa, and both lacked a nesium. A broad gymnoparia and the presence of phobae were also shared with the wood-decomposing larva of Sinodendron rugosum (Lucanidae), suggesting a potential functional convergence among detritus-feeding taxa. Additionally, Melolonthinae retained a small number of phobae on the haptolachus, indicating partial retention of ancestral epipharyngeal structures.

4. Discussion

This study provides the first comparative SEM-based assessment of larval mouthparts across ten scarabaeoid lineages and evaluates seventeen characters within an explicit molecular phylogenetic framework. Three of these characters were recovered as putative synapomorphies within the sampled framework, being potentially informative for Scarabaeidae, for the clade Cetoniinae + (Rutelinae + Dynastinae), and for the coprophagous Aphodiinae + Scarabaeinae, respectively. Several additional traits show repeated evolutionary origins and exhibit clear associations with feeding mode, illustrating how larval mouthpart morphology tracks functional diversification across major scarabaeoid lineages.

Extensive phylogenetic studies of Scarabaeoidea have relied on diverse datasets, including Sanger loci and multilocus DNA sequences (Caterino et al. 2005; Smith et al. 2006; Ahrens et al. 2014; McKenna et al. 2015; Song and Zhang 2018; Ahrens et al. 2020; Beza-Beza et al. 2020; Cai et al. 2022; Dietz et al. 2023) as well as morphology-based character matrices (Browne and Scholtz 2002; Grebennikov and Scholtz 2004; Lawrence et al. 2011). The topology obtained here is broadly congruent with previous mitogenomic studies (Song and Zhang 2018; Ayivi et al. 2021; Guo et al. 2022), and with multi-locus and genomic reconstructions (McKenna et al. 2019; Cai et al. 2022; Dietz et al. 2023), in recovering a major split within Scarabaeidae between the coprophagous clade Aphodiinae + Scarabaeinae and the phytophagous scarabs, and in placing Sericinae as the earliest-diverging lineage of the phytophagous assemblage, with Cetoniinae + (Dynastinae + Rutelinae) forming the more derived part of that clade. However, our results differ from some previous studies in several respects. Most notably, the monophyly of Melolonthinae recovered here is inconsistent with the result of Gunter et al. (2016). Likewise, the sister-group relationship between the coprophagous and phytophagous clades in our topology was not supported by Ahrens et al. (2014), Bocak et al. (2014), or Grebennikov and Scholtz (2004). Such differences may be attributable, at least in part, to the use of different datasets and analytical frameworks, but they may also more directly reflect the limited taxon sampling in the present study.

The epipharynx is one of the most variable structures among scarabaeoid larvae, with pronounced differences in spines, sensilla, setae, heli, phobae, and sclerotized processes across lineages and feeding guilds (Hayes 1928, 1929; Browne and Scholtz 2002; Grebennikov and Scholtz 2004; Šípek and Ahrens 2011; Qu et al. 2019). Within Scarabaeidae, two key structures—helus and circularly arranged phobae—are mutually exclusive and have never been documented together in a single species (Ritcher 1966; Zhang 1984). Circularly arranged phobae or subcircular phobal fields have been mostly clearly documented in coprophagous Aphodiinae and Scarabaeinae (Verdú and Galante 2000; Martínez and Lumaret 2005; Frolov et al. 2021), whereas helus has mainly been reported from phytophagous Sericinae, Melolonthinae, and several Rutelinae (Anomalini, Adoretini) (Morón and Paucar-Cabrera 2003; Šípek and Ahrens 2011; Cuate-Mozo et al. 2014; Lugo-García et al. 2018; Begha and Santos 2020; Zhang et al. 2024). Notably, although larvae of Glaphyridae, a basal lineage of Scarabaeoidea, are also soil-dwelling and phytophagous, available descriptions suggest that they lack helus (Ritcher 1966), implying that similar feeding habits do not necessarily involve the same epipharyngeal modification across Scarabaeoidea. Our ancestral-state reconstruction supports circular phobae as a putative synapomorphy of the sampled coprophagous Aphodiinae + Scarabaeinae, whereas helus represents a homoplastic acquisition among phytophagous white grubs (Jia et al. 2023; Cao et al. 2024; Fuhrmann et al. 2024), suggesting that helus may have evolved convergently within Scarabaeidae as one recurrent morphological response to subterranean phytophagy rather than as a universal scarabaeoid adaptation.

Mandibular morphology also varies widely across families and feeding modes (Lawrence and Ślipiński 2013; Beutel and Yavorskaya 2019). Mandibles are symmetric only in Passalidae (Grebennikov and Scholtz 2004; Mattos et al. 2015), but become apically curved, dentate, and sharply pointed in coprophagous Aphodiinae and Scarabaeinae (Edmonds and Halffter 1978; Li et al. 2019) or saprophagous Lucanidae, Cetoniinae, and Dynastinae (Sousa et al. 2018; Jang and Kim 2019; Qu et al. 2019; Dong and Jiang 2023). Blade-like incisors characterize phytophagous Sericinae, Melolonthinae, and Rutelinae (Ernesto and Carrillo 2010; Filippini et al. 2017; Neita-Moreno and Morón 2017; Jia et al. 2020; Šípek and Ahrens 2011; Cao et al. 2024). Our analyses corroborate that these blade-like incisors have evolved multiple times in plant-feeding lineages and likely represent functional adaptations to cutting subterranean roots (Ritcher 1966; Jia et al. 2021, 2023; Zhang et al. 2024). Even within Rutelinae, the trait is not phylogenetically stable, occurring in phytophagous species but not in saproxylic taxa (Fang et al. 2018; Sun et al. 2024). This pattern is consistent with the broader ecological diversity of Rutelinae larvae, especially within Rutelini, where larvae are frequently saproxylic and associated with decaying wood or other decomposing organic substrates rather than living roots (Jameson and Morón 2001; Sun et al. 2024), and further supports the view that blade-like incisors track feeding substrate rather than subfamily identity.

Mandibles also play a central role in larval stridulation (Ritcher 1966; Dong and Jiang 2023) producing species-specific signals (Görres and Chesmore 2019) using ventral ridges whose number and arrangement vary widely (Balaguer et al. 2008). Our reconstruction indicates that dense stridulatory ridges may represent a putative synapomorphy of the sampled Cetoniinae, Rutelinae, and Dynastinae (Ritcher 1948; Bedford 1974; Ibarra-Polesel et al. 2020, 2022; Uliana et al. 2023). Other lineages lack these ridges: they are absent in Lucanidae, Passalidae, and Geotrupidae (Grebennikov and Scholtz 2004), replaced by a single sclerotized ridge in some Sericinae (Šípek and Ahrens 2011; Cao et al. 2024), a glabrous surface in some Melolonthinae (Jia et al. 2020, 2023; Zhang et al. 2024), or granular processes in others (Jia et al. 2021; Rana et al. 2022). The striking heterogeneity within Melolonthinae likely reflects the known paraphyly of this subfamily (Ahrens et al. 2014; Guo et al. 2022; Dietz et al. 2023).

Maxillary stridulatory teeth, described across many white grubs (Orozco and Pardo-Locarno 2004; Roggero et al. 2013; Shabalin 2017), typically interact with mandibular ridges in Cetoniinae, Rutelinae, and Dynastinae (Ratcliffe and Skelley 2011; Dong et al. 2021; Sun et al. 2024). Unexpectedly, however, maxillary teeth also occur in Aphodiinae, Scarabaeinae, Sericinae, Melolonthinae, and Euchirinae (Edmonds and Halffter 1978; Šípek et al. 2011; Li et al. 2019; Jia et al. 2023), even though these lineages lack mandibular ridges. The widespread occurrence of maxillary teeth implies that stridulatory structures originated before the evolution of specialized mandibular files, but the acoustical mechanism remains poorly understood. Our analyses support maxillary stridulatory teeth as a potential synapomorphy of Scarabaeidae within the sample taxa (Fig. 11; Clade D).

The limited sampling in the present study did not include Geotrupidae, Bolboceratidae, Trogidae, or Glaphyridae, mainly because specimens for which both larval morphological information and mitogenomic sequences are available remain extremely scarce. Nevertheless, comparison with previous reports on larval morphology and biology (Verdú et al. 2004; Bezborodov and Koshkin 2015; Costa-Silva and Smith 2024), suggests that some of the patterns inferred in our sampled framework may extend beyond the taxa included here. In particular, the circular phoba complex together with the absence of nesium, which in our sampled taxa appears to characterize coprophagous larvae, is also reported in the coprophagous Geotrupidae and Bolboceratidae (Verdú et al. 2004). The circular phoba complex is likewise present in the keratin-feeding larvae of Trogidae (Costa-Silva and Smith 2024), although the absence of nesium does not appear to apply to this group (Ritcher 1966). These comparisons suggest that the circular phoba complex may be more broadly associated with non-phytophagous feeding habits, whereas loss of the nesium may be more restricted. At the same time, such inferences should be treated cautiously, because the present study is limited by incomplete larval sampling across Scarabaeoidea, and broader taxon coverage will be needed to test the generality of these patterns.

Larval mouthparts are multifunctional structures involved not only in feeding but also locomotion and communication (Stehr 1987; Chapman 2013), and thus are shaped by strong selective pressures. Within a phylogenetic framework, we show that three characters emerge as potentially informative synapomorphies within the sampled framework, enhancing their value for morphological systematics (Hayes 1929; Van Emden 1957; Ritcher 1966; Browne and Scholtz 2002; Grebennikov and Scholtz 2004). Fourteen additional characters show homoplastic distributions, yet still retain an apparent ecological signal, particularly with respect to feeding mode (Krenn 2019). The diversity documented here likely represents only a fraction of the morphological variation present across Scarabaeoidea. Broader sampling and detailed morphological-functional analyses will be essential for elucidating larval evolution and for improving pest management or conservation applications.

5. Declarations

Conflict of interest. The authors declare that they have no conflicts of interest in relation to this work.

Author contributions. Wenjun Cao (Conceptualization [Equal], Data curation [Lead], Investigation [Lead], Methodology [Lead], Visualization [Lead], Writing–original draft [Lead]), Lu Jiang (Corresponding Author, Conceptualization [Equal], Supervision [Lead], Writing–review and editing [Lead])

Data availability. All new five mtGenomes generated in this study were deposited in GenBank under accession numbers PQ067330-PQ067331 and PQ083081-PQ083083.

6. Acknowledgements

We are grateful to Mr. Zong-Fei Qu and Mr. Yue-Tian Gao for their assistance with mitogenome assembly and annotation. We also thank Dr. Ying Lu for providing part of the specimens in Aphodiinae. Our special thanks go to the two reviewers for their thoughtful and constructive suggestions. This research was financially supported by the National Natural Science Foundation of China (grant nos. 32370470 and 31702036), and Scientific Research Foundation for the Introduced Talent of Shenyang Agricultural University (grant no. 880417008).

7. References

  • Ahrens D, Eberle J, Fabrizi S, Sabatinelli G (2020) A molecular phylogeny of Glaphyridae (Coleoptera: Scarabaeoidea): evolution of pollination and association with ‚Poppy guild‘ flowers. Systematic Entomology 45: 838–848. https://doi.org/10.1111/syen.12429
  • Ahrens D, Schwarzer J, Vogler AP (2014) The evolution of scarab beetles tracks the sequential rise of angiosperms and mammals. Proceedings of the Royal Society B Biological Sciences 281: 20141470. https://doi.org/10.1098/rspb.2014.1470
  • Allibert A (1847) Note sur divers insectes Coléoptères trouves dans des grains de légumineuses rapportées de Canton par M.Yvan, medicin de l’ambassade française en Chine, et sur quelques autres espèces qui ont vécu dans des haricots venant du Brésil. Revue Zoologique 10: 11–19.
  • Angelini DR, Smith FW (2019) Theme and Variation in the Development of Insect Mouthparts. Cham: Springer International Publishing.
  • Ansari MA, Casteels H, Tirry L, Moens M (2006) Biology of Hoplia philanthus (Col., Scarabaeidae, Melolonthinae): A new and severe pest in Belgian turf. Entomological Review 35: 1500–1507. https://doi.org/10.1093/ee/35.6.1500
  • Ayivi SPG, Tong Y, Storey K, Yu D, Zhang JY (2021) The mitochondrial genomes of 18 new pleurosticti (Coleoptera: Scarabaeidae) exhibit a novel trnQ-NCR-trnI-trnM gene rearrangement and clarify phylogenetic relationships of subfamilies within Scarabaeidae. Insects 12: 1025. https://doi.org/10.3390/insects12111025
  • Balaguer E, Morón M, Šípek P, Galante E (2008) Larval morphology enhances phylogenetic reconstruction in Cetoniidae (Coleoptera: Scarabaeoidea) and allows the interpretation of the evolution of larval feeding habits. Systematic Entomology 33: 128–144. https://doi.org/10.1111/j.1365-3113.2007.00399.x
  • Bedford GO (1974) Descriptions of the larvae of some rhinoceros beetles (Col., Scarabaeidae, Dynastinae) associated with coconut palms in New Guinea. Bulletin of Entomological Research 63: 445–472. https://doi.org/10.1017/s0007485300040943
  • Begha B, Santos M (2020) Description of the third instar larva and pupa of Macraspis morio Burmeister, 1844 (Coleoptera: Scarabaeidae: Rutelinae) from Southern Brazil. Papeis Avulsos de Zoologia 60: e20206034. https://doi.org/10.11606/1807-0205/2020.60.34
  • Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, Pütz J, Middendorf M, Stadler PF (2013) MITOS: Improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69: 313–319. https://doi.org/10.1016/j.ympev.2012.08.023
  • Beutel RG, Yavorskaya M (2019) Structure and Evolution of Mouthparts in Coleoptera. Cham: Springer International Publishing.
  • Beza-Beza C, Beck J, Reyes-castillo P, Jameson M (2017) Phylogeny of the genus Yumtaax Boucher (Coleoptera, Passalidae, Proculini): Taxonomic and evolutionary implications with descriptions of three new species. ZooKeys 667: 95–129. https://doi.org/10.3897/zookeys.667.10716
  • Beza-Beza CF, Jimenez-Ferbans L, McKenna DD (2020) Phylogeny and Systematics of Wood-Degrading Neotropical Bess Beetles (Coleoptera: Passalidae: Passalinae). Arthropod Systematics & Phylogeny 78: 287–308. https://doi.org/10.26049/asp78-2-2020-05.
  • Bezborodov V, Koshkin E (2015) A review of Bolboceratidae (Coleoptera, Scarabaeoidea) species from the Russian Far East. Entomological Review 94: 1313–1319.
  • Blanke A, Rühr PT, Mokso R, Villanueva P, Wilde F, Stampanoni M, Uesugi K, Machida R, Misof B (2015) Structural mouthpart interaction evolved already in the earliest lineages of insects. Proceedings of the Royal Society B Biological Sciences 282: 20151033. https://doi.org/10.1098/rspb.2015.1033
  • Bocak L, Barton C, Crampton-Platt A, Chesters D, Ahrens D, Vogler AP (2014) Building the Coleoptera tree-of-life for >8000 species: composition of public DNA data and fit with Linnaean classification. Systematic Entomology 39: 97–110. https://doi.org/10.1111/syen.12037
  • Böving AG (1936) Description of the larva of Plectris aliena Chapin and explanation of new terms applied to the epipharynx and raster. Proceedings of the Entomological Society of Washington 38: 169–185.
  • Böving AG (1942) Description of the larva of some west indian Melolonthinae beetles and a key to the known larvae of the tribe. Proceedings of the United States National Museum 92: 167–175. https://doi.org/10.5479/si.00963801.92-3146.167
  • Cabrero-Sañudo FJ, Zardoya R (2004) Phylogenetic relationships of Iberian Aphodiini (Coleoptera: Scarabaeidae) based on morphological and molecular data. Molecular Phylogenetics and Evolution 31: 1084–1100. https://doi.org/10.1016/j.ympev.2003.10.019
  • Cave RD, Ratcliffe BC (2008) Scarab Beetles (Coleoptera: Scarabaeoidea). In: Capinera, J. F., (Ed.) Encyclopedia of Entomology, pp. 3273–3286. Springer.
  • Cai C, Tihelka E, Giacomelli M, Lawrence JF, Ślipiński A, Kundrata R, Yamamoto S, Thayer MK, Newton AF, Leschen RAB, Gimmel ML, Lü L, Engel MS, Bouchard P, Huang D, Pisani D, Donoghue PCJ (2022) Integrated phylogenomics and fossil data illuminate the evolution of beetles. Royal Society Open Science 9: 211771. https://doi.org/10.1098/rsos.211771
  • Cao WJ, Chen YN, Zhou RJ, Jiang L (2024) Cross-instar larval identification leads divergent decision on pest management: An example from white grubs on peanuts. Journal of Asia-Pacific Entomology 27: 102283. https://doi.org/10.1016/j.aspen.2024.102283
  • Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T (2009) trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25: 1972–1973. https://doi.org/10.1093/bioinformatics/btp348
  • Chapman RF (2013) The Insects: Structure and Function. 5th ed. Cambridge: Cambridge University Press.
  • Chen YN, Ying M, Lu C, Jiang L (2025) Consumer or decomposer? Behavioral and morphological diagnosis of white grubs. Ecology and Evolution 15: e71925. https://doi.org/10.1002/ece3.71925
  • Cuate-Mozo VA, Aragón-García A, Pérez-Torres BC, Morón MÁ, López-Olguín JF, Marco-Mancebón VS (2014) Descriptions of the larvae of two pecies of Paranomala and one species of Strigoderma (Coleoptera: Melolonthidae: Rutelinae) from Puebla, Mexico. Acta Biologica Colombiana 19: 195–202. https://doi.org/10.15446/abc.v19n2.40682
  • Costa-Silva V, Smith AB (2024) Description of the larva of Polynoncus hemisphaericus (Burmeister, 1876)(Coleoptera: Trogidae: Omorginae). The Coleopterists Bulletin 78: 439–446.
  • Dietz L, Seidel M, Eberle J, Misof B, Pacheco TL, Podsiadlowski L, Ranasinghe S, Gunter NL, Niehuis O, Mayer C, Ahrens D (2023) A transcriptome-based phylogeny of Scarabaeoidea confirms the sister group relationship of dung beetles and phylophagous pleurostict scarabs (Coleoptera). Systematic Entomology 48: 672–686. https://doi.org/10.1111/syen.12602
  • Dong XM, Jia ZC, Jiang L (2021) Morphological description of the third instar larva of Lasiotrichius succinctus hananoi (Sawada) (Coleoptera: Scarabaeidae: Cetoniinae: Trichiini), using scanning electron microscopy. Microscopy Research and Technique 84: 368–375. https://doi.org/10.1002/jemt.23594
  • Dong XM, Jiang L (2023) Species-specific larval acoustic behaviour of three stag beetles (Coleoptera: Lucanidae), with emphasis on their stridulatory organs and acoustic signals. Arthropod Structure & Development: 101300. https://doi.org/10.1016/j.asd.2023.101300
  • Ernesto C, Carrillo R (2010) Description of the Larvae of Phytholaema herrmanni Germain and Phytholaema dilutipes (Fairmaire and Germain) (Coleoptera: Scarabaeidae: Melolonthinae). Coleopterists Bulletin 64: 141–147. https://doi.org/10.1649/072.064.0210
  • Faldermann F (1835) Coleopterorum ab illustrissimo Bungio in China boreali, Mongolia et montibus altaicis collectorum nec non ab ill. Turchaninoffio et Stschukinoe e provincia Irkutsk missorum illustrationes. Mémoires De l’Academie Imperiale Des Sciences De Saint Petersbourg 6: 337–464.
  • Fang H, Li C, Jiang L (2018) Morphology of the immature stages of Adoretus tenuimaculatus Waterhouse, 1875 (Coleoptera: Scarabaeidae: Rutelinae: Adoretini). Journal of Asia-pacific Entomology 21: 1159–1164. https://doi.org/10.1016/j.aspen.2018.09.001
  • Filippini V, Onore G, Guidolin L (2017) Larval and pupal descriptions of Anomalini (Coleoptera: Scarabaeidae: Rutelinae) species from Ecuador. Zootaxa 4227: 196–218. https://doi.org/10.11646/zootaxa.4227.2.3
  • Frolov AV, Vishnevskaya MS, Akhmetova LA (2021) Identification of larvae of two Aphodius Helwig, 1798 (Coleoptera: Scarabaeidae: Aphodiinae) species using morphology and DNA barcode. Zootaxa 5047: 153–164. https://doi.org/10.11646/zootaxa.5047.2.4
  • Fuhrmann J, Sousa R, Grossi P, Cherman M (2024) The third instar larva of Eunanus valmorbidai Ferreira, Grossi & Seidel, 2024 with notes on Geniatini larvae (Coleoptera: Melolonthidae: Rutelinae). Papeis Avulsos de Zoologia 64: e202464036. https://doi.org/10.11606/1807-0205/2024.64.036
  • Görres CM, Chesmore D (2019) Active sound production of scarab beetle larvae opens up new possibilities for species-specific pest monitoring in soils. Scientific Reports 9: 10115. https://doi.org/10.1038/s41598-019-46121-y
  • Grebennikov VV, Scholtz CH (2004) The basal phylogeny of Scarabaeoidea (Insecta: Coleoptera) inferred from larval morphology. Invertebrate Systematics 18: 321–348. https://doi.org/10.1071/IS03013
  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59: 307–321. https://doi.org/10.1093/sysbio/syq010
  • Gunter NL, Weir TA, Ślipiński A, Bocak L, Cameron SL (2016) If dung beetles (Scarabaeidae: Scarabaeinae) arose in association with dinosaurs, did they also suffer a mass co-extinction at the K-Pg boundary? PLoS One 11: e0153570. https://doi.org/10.1371/journal.pone.0153570
  • Harrison JduG, Wingfield MJ (2016) A taxonomic review of white grubs and leaf chafers (Coleoptera: Scarabaeidae: Melolonthinae) recorded from forestry and agricultural crops in Sub-Saharan Africa. Bulletin of Entomological Research 106: 141–153. https://doi.org/10.1017/s0007485315000565
  • Hayes WP (1928) The epipharynx of lamellicorn larvae (Coleop.), with a Key to Common Genera. Annals of The Entomological Society of America 21: 282–306. https://doi.org/10.1093/aesa/21.2.282
  • Hayes WP (1929) Morphology, taxonomy, and biology of larval Scarabaeoidea. The university of illinois.
  • Huang TI (2018) Diversity and Ecology of Stag Beetles (Lucanidae). Ulyshen MD (Ed.), Saproxylic Insects: Diversity, Ecology and Conservation (pp. 149–165). Cham: Springer International Publishing 149–165.
  • Ibarra-Polesel MG, Neita-Moreno JC, Ratcliffe BC (2020) Description of the immature stages of Stenocrates agricola Dechambre & Hardy (Coleoptera: Scarabaeidae: Dynastinae: Cyclocephalini) with redescription of the adult and discussion of its tribal position. Anais Da Academia Brasileira De Ciencias 92: e20190967. https://doi.org/10.1590/0001-3765202020190967
  • Ibarra-Polesel MG, Valle NG, Cave RD, Damborsky MP (2022) Descriptions of the larva and pupa of Gymnetis pudibunda Burmeister, 1866 (Coleoptera: Scarabaeidae: Cetoniinae: Gymnetini), with notes on natural history and a key to the known larvae of New World Gymnetini. Journal of Natural History 56: 969–987. https://doi.org/10.1080/00222933.2022.2080607
  • Jameson ML, Morón MA (2001) Descriptions of the larvae of Chlorota cincticollis Blanchard and Chasmodia collaris (Blanchard) (Scarabaeidae: Rutelinae: Rutelini) with a key to the larvae of the American genera of Rutelini. The Coleopterists Bulletin 55: 385–396.
  • Jang YC, Kim SK (2019) Description of larva and pupa of Pentodon quadridens bidentulus (Fairmaire, 1887) (Coleoptera, Scarabaeidae, Dynastinae) and notes on its biology larva and pupa of Pentodon quadridens bidentulus. Korean Journal of Applied Entomology 58: 165–174. https://doi.org/10.5656/KSAE.2019.06.0.018
  • Jia ZC, Dong H, Li YT, Zhao XX, Jiang L (2023) Morphology of a grass-feeding white grub Apogonia cupreoviridis (Coleoptera: Scarabaeidae: Melolonthinae: Diplotaxini) using scanning electron microscopy. Acta Zoologica 105: 225–233. https://doi.org/10.1111/azo.12460
  • Jia ZC, Fang H, Jiang L (2021) Morphological description of the white grub Melolontha incana (Coleoptera: Scarabaeidae: Melolonthinae: Melolonthini). Microscopy Research and Technique 84: 921–928. https://doi.org/10.1002/jemt.23653
  • Jia ZC, Lu C, Zhou RJ, Jiang L (2020) Comparative morphology between the white grubs Pseudosymmachia tumidifrons and Brahmina faldermanni (Coleoptera: Scarabaeidae: Melolonthinae) using scanning electron microscopy. Zoologischer Anzeiger 289: 8–17. https://doi.org/10.1016/j.jcz.2020.08.008
  • Jiang L, Hua BZ (2015) Morphological comparison of the larvae of Panorpa obtusa Cheng and Neopanorpa lui Chou & Ran (Mecoptera: Panorpidae). Zoologischer Anzeiger 225: 62–70. https://doi.org/10.1016/j.jcz.2015.02.004
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. https://doi.org/10.1093/bioinformatics/bts199
  • Krenn HW (2019) Form and Function of Insect Mouthparts. Cham: Springer International Publishing.
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.org/10.1093/molbev/msw260
  • Lawrence JF (1991) Order Coleoptera. In F. W. Stehr (Ed.), Immature Insects (Vol. 2, pp. 144–658). Dubuque, Iowa: Kendall/Hunt Publishing Company.
  • Lawrence J, Ślipiński A (2013) Australian beetles volume 1: Morphology, Classification and Keys. CSIRO publishing: 1–217.
  • Lawrence JF, Ślipiński A, Seago AE, Thayer MK, Newton AF, Marvaldi AE (2011) Phylogeny of the Coleoptera based on morphological characters of adults and larvae. Annales Zoologici 61: 1–217. https://doi.org/10.3161/000345411X576725
  • Li C, Lu Y, Fang H, Jiang L (2019) Morphology of the third instar larva of Colobopterus quadratus (Coleoptera: Scarabaeidae: Aphodiinae) using scanning electron microscopy. Microscopy Research and Technique 82: 1372–1379. https://doi.org/10.1002/jemt.23289
  • Linnaeus C (1771) Carl Linnaeus Mantissa Plantarum, with an introduction by William TS. 6: 137–588.
  • Long TT, Jiang R, Zhu W, Long J, Chen X (2024) Biology of Callistethus plagiicollis (Coleoptera: Scarabaeoidea: Rutelinae) and comparative morphology of its larvae. Microscopy Research and Technique 87: 1693–1703. https://doi.org/10.1002/jemt.24555
  • Lugo-García G, Cuate-Mozo VA, Cortez K (2018) Description of the larvae of Faula jaliscoensis (Delgado & Navarrete-Heredia) (Coleoptera: Scarabaeidae: Melolonthinae) from Nayarit, Mexico. Zootaxa 4527: 297–300. https://doi.org/10.11646/zootaxa.4527.2.12
  • Maddison WP, Maddison DR (2011) Mesquite: a modular system for evolutionary analysis. Version 2.75.
  • Martínez MI, Lumaret JP (2005) Structure of the terminal ampulla in male larvae of Canthon cyanellus LeConte (Coleoptera: Scarabaeidae: Scarabaeinae). Coleopterists Bulletin 59: 35–39. https://doi.org/10.1649/681
  • Mattos I, Miras Mermudes JR, Reyes-Castillo P (2015) Larval structure of Passalus gravelyi and sexual dimorphism in passalid larvae. Revista de Biología Tropical 63: 695–704.
  • Mckenna DD, Shin S, Ahrens D, Balke M, Beza-Beza C, Clarke DJ, Donath A, Escalona HE, Friedrich F, Letsch H, Liu S, Maddison D, Mayer C, Misof B, Murin PJ, Niehuis O, Peters RS, Podsiadlowski L, Pohl H, Scully ED, Yan EV, Zhou X, Ślipiński A, Beutel RG (2019) The evolution and genomic basis of beetle diversity. Proceedings of the National Academy of Sciences of the United States of America 116: 24729–24737. https://doi.org/10.1073/pnas.1909655116
  • McKenna DD, Wild AL, Kanda K, Bellamy CL, Beutel R, Caterino MS, Farnum CW, Hawks DC, Ivie MA, Jameson ML, Leschen RAB, Marvaldi AE, McHugh JV, Newton AF, Robertson JA, Thayer MK, Whiting MF, Lawrence JF, Ślipiński SA, Maddison DR, Farrell BD (2015) The beetle tree of life reveals Coleoptera survived end permian mass extinction to diversify during the Cretaceous terrestrial revolution. Systematic Entomology 40: 835–880. https://doi.org/10.1111/syen.12132
  • Medvedev SI (1952) Larvae of Lamellicornia of the USSR. Moskva: Leningrad.
  • Meng GL, Li YY, Yang CT, Liu SL (2019) MitoZ: A toolkit for animal mitochondrial genome assembly, annotation and visualization. Nucleic Acids Research 47: e63–e63. https://doi.org/10.1093/nar/gkz173
  • Minoshima Y, Hayashi M (2011) Larval morphology of the Japanese species of the tribes Acidocerini, Hydrobiusini and Hydrophilini (Coleoptera: Hydrophilidae). Acta Entomologica Musei Nationalis Pragae 5: 1–118.
  • Morón MA, Paucar-Cabrera A (2003) Larvae and pupae of species of the genus Macraspis (Coleoptera: Scarabaeidae: Rutelinae: Rutelini). The Canadian Entomologist 135: 467–491. https://doi.org/10.4039/n02-091
  • Motschulsky V (1854) Nouveautés. Etudes Entomologiques. Helsingfors: Société de litérature.
  • Motschulsky V (1857) Entomologie speciale. Insectes du Japon. Etudes Entomologiques. Helsingfors: Société de litérature.
  • Neita-Moreno J, Morón M (2017) Description of immature stages of Platycoelia valida Burmeister, 1844 (Coleoptera: Melolonthidae: Rutelinae: Anoplognathini). Revista Brasileira de Entomologia 61: 359–364. https://doi.org/10.1016/j.rbe.2017.07.002
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300
  • Nichols L, Spector S, Louzada J, Larsen T, Amézquita S, Favila M (2008) Ecological functions and ecosystem services provided by Scarabaeinae dung beetles. Biological Conservation 141: 1461–1474. https://doi.org/10.1016/j.biocon.2008.04.011
  • Orozco J, Pardo-Locarno LC (2004) Description of immature stages of three species of American Cetoniinae (Coleoptera: Scarabaeidae: Cetoniinae). Zootaxa 769: 1–14. https://doi.org/10.11646/zootaxa.769.1.1
  • Pallas PS (1781) Icones Insectorum praesertim Rossiae Siberiaeque pecularium quae collegit et Descriptionibus illustravit. Erlangae: Sumptu Wolfgangi Waltheri. https://doi.org/10.5962/bhl.title.15809
  • Parry FJS (1873) Characters of seven nondescript Lucanoid Coleoptera, and remarks upon the genus Lissotes, Nigidius and Figulus. Transactions of the Royal Entomological Society of London 21: 335–345. https://doi.org/10.1111/j.1365-2311.1873.tb02310.x
  • Qu ZF, Jia ZC, Jiang L (2019) Description of the third instar larva of the stag beetle Prismognathus dauricus Motschulsky, 1860 (Coleoptera: Scarabaeoidea: Lucanidae) using electron microscopy. Micron 120: 10–16. https://doi.org/10.1016/j.micron.2019.02.001
  • Rana A, Chandel RS, Verma KS (2022) Morphological description and identification of Melolontha cuprescens, Melolontha furcicauda and Melolontha indica (Coleoptera: Scarabaeidae): serious root feeding and defoliating pests in India. Phytoparasitica 50: 281–305. https://doi.org/10.1007/s12600-021-00961-5
  • Ranwez V, Douzery EJP, Cambon C, Chantret N, Delsuc F (2018) MACSE v2: Toolkit for the alignment of coding sequences accounting for frameshifts and stop codons. Molecular Biology and Evolution 35: 2582–2584. https://doi.org/10.1093/molbev/msy159
  • Ratcliffe B, Skelley P (2011) Description of the Larva of Homophileurus integer (Burmeister, 1847) (Coleoptera: Scarabaeidae: Dynastinae: Phileurini), with Notes on Biology and a Key to the Known Larvae of New World Phileurini. Coleopterists Bulletin 65: 297–304. https://doi.org/10.1649/072.065.0311
  • Ritcher PO (1948) Descriptions of the larvae of some Ruteline beetles with keys to tribes and species (Scarabaeidae). Annals of The Entomological Society of America 41: 206–212. https://doi.org/10.1093/aesa/41.2.206
  • Ritcher PO (1966) White grubs and their allies. A study of North American Scarabaeoid larvae. Corvallis: Oregon State University Press.
  • Rodrigues SR, Barbosa CAF, Fuhrmann J, Amaro RA (2018) Mating behavior and description of immature stages of Cyclocephala melanocephala (Fabricius, 1775) (Coleoptera: Scarabaeidae: Dynastinae), identification key and remarks on known immatures of Cyclocephalini species. Revista Brasileira de Entomologia 62: 205–219. https://doi.org/10.1016/j.rbe.2018.07.001.
  • Roggero A, Tocco C, Palestrini C (2013) Description of the larval instars of Amidorus immaturus (Mulsant, 1842) (Coleoptera: Scarabaeoidea: Aphodiidae). Turkish Journal of Zoology 37: 50–58. https://doi.org/10.3906/zoo-1202-21
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Sawada H (1991) Morphological and Phylogenetical Study on the Larvae of Pleurostict Lamellicornia in Japan. Tokyo: Tokyo University of Agriculture Press.
  • Scholtz CH, Davis ALV, Kryger U (2009) Evolutionary Biology and Conservation of Dung Beetles. Bulgaria: Pensoft Sofia-Moscow.
  • Scholtz CH, Grebennikov VV (2016) 15. Scarabaeoidea Latreille, 1802. Berlin, Boston: De Gruyter.
  • Shabalin SA (2017) Descriptions of the larvae of the beetle family Trogidae (Coleoptera, Scarabaeoidea) from the Russian Far East. Entomological Review 97: 1106–1112. https://doi.org/10.1134/S0013873817080103
  • Šípek P (2010) Immature stages of the pleurostict scarab beetles (Coleoptera: Scarabaeidae: Pleurosticti): Morphology, biology and phylogenetic implication. Prague: Charles University.
  • Šípek P, Jansta P, Král D (2011) Immature stages of Euchirinae (Coleoptera: Scarabaeoidea): Genera Cheirotonus and Propomacrus with comments on their phylogeny based on larval and adult characters. Invertebrate systematics 25: 282–302. https://doi.org/10.1071/IS11028
  • Šípek P, Král D (2012) Immature stages of the rose chafers (Coleoptera: Scarabaeidae: Cetoniinae): a historical overview. Zootaxa 3323: 1–26.
  • Sousa R, Fuhrmann J, Kouklík O, Šípek P (2018) Immature stages of three species of Inca LePeletier & Serville, 1828 (Coleoptera: Scarabaeidae: Cetoniinae) and morphology of phytophagous scarab beetle pupa. Zootaxa 4434: 65–88. https://doi.org/10.11646/zootaxa.4434.1.4
  • Stehr FW (1987) Immature insects (Vol. 1). Dubuque, Iowa: Kendall/Hunt Publishing Company.
  • Sun XY, Dong XM, Jiang L (2024) Larval morphology of a Palearctic Rutelini, Parastasia ferrieri (Coleoptera, Scarabaeidae), with discussions on their feeding habits. Deutsche Entomologische Zeitschrift 71: 185–192. https://doi.org/10.3897/dez.71.113727
  • Uliana M, Tomasi F, Gallerati V (2023) An unexpected new species of Anomala Samouelle, 1819 from southern Italy (Coleoptera: Scarabaeidae: Rutelinae), including description of its larva and ecological notes. Zootaxa 5325: 186–206. https://doi.org/10.11646/zootaxa.5325.2.2
  • Ulyshen MD (2018) Ecology and Conservation of Passalidae. Cham: Springer International Publishing 129–147.
  • Verdú JR, Galante E (2000) Larval morphology and biology of two species of Aphodius (Plagiogonus) from the Iberian Peninsula (Coleoptera: Scarabaeidae: Aphodiinae). European Journal of Entomology 97: 395–401. https://doi.org/10.14411/eje.2000.060
  • Xiang CY, Gao F, Jakovlić I, Lei HP, Hu Y, Zhang H, Zou H, Wang GT, Zhang D (2023) Using phylosuite for molecular phylogeny and tree-based analyses. Imeta 2: e87. https://doi.org/10.1002/imt2.87
  • Zhang D, Gao FL, Li WX, Jakovlić I, Zou H, Zhang J, Wang GT (2020) PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. BioRxiv. https://doi.org/10.1111/1755-0998.13096
  • Zhang GZ, Wang XT, Li YT, Fang H, Jiang L (2024) Ultramorphology of the third instar larvae of Miridiba trichophora (Coleoptera: Melolonthinae: Rhizotrogini). Zoomorphology 143: 681–690. https://doi.org/10.1007/s00435-024-00678-z
  • Zhang ZL (1984) Economic Insect Fauna of China, Fascicule 28, Coleoptera: Larvae of Scarabaeoidea. Beijing Science Press.

Supplementary material

Supplementary material 1 

Table SS1, S2; Files S1–S5

Cao WJ, Jiang L (2026)

Data type: .zip

Explanation notes: Table SS1. MtGenomes information of Scarabaeoidea were deposited and downloaded from GenBank, along with the corresponding references of third-instar larval mouthparts [.docx file]. — Table SS2. The characteristic codes of 23 larval mouthparts (seventeen characters) [.docx file]. — File S1. COI of Ophrygonlus sp. [.fas file]. — File S2. Mitogenomic organization and composition [.rar file]. — File S3. Phylogenetic analysis data [.rar file]. — File S4. Phylogenetic tree based on five datasets 13PCGs, 13PCGsAA, 13PCGs12, PCG2rRNA, PCG12rRNA datasets [.rar file]. — File S5. The 17 ancestral character reconstructions based on the BI topology (PCGs2rRNA) [.pdf file].

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (14.21 MB)
login to comment