Research Article
Print
Research Article
Revisiting Lamprosoma and expanding knowledge of Lychnophaes (Coleoptera: Chrysomelidae, Lamprosomatinae): Molecular phylogeny, new species, host plants, associated parasitoid wasps and geographical records
expand article infoAluska Tavares Santos§, Isaac Reis Jorge|, Marcos Fianco, Aline Sampaio#¤, André Luis Martins«», José Albertino Rafael¤, Andressa Paladini, Paulo Henrique Gorgatti Zarbin
‡ Laboratório de Semioquímicos, Setor de Ciências Exatas, Departamento de Química, Universidade Federal do Paraná (UFPR), Curitiba, Brazil
§ Laboratorio de Ecología Química. Instituto de Química, Pontificia Universidad Católica de Valparaíso, Valparaíso, Chile
| Laboratório de Estudos em Diversidade de Insetos da Região Neotropical, Setor de Ciências Biológicas, Departamento de Zoologia, Universidade Federal do Paraná (UFPR), Curitiba, Brazil
¶ Laboratório de Biologia Comparada de Hymenoptera, Setor de Ciências Biológicas, Departamento de Zoologia, Universidade Federal do Paraná (UFPR), Curitiba, Brazil
# Museo del Instituto de Zoología Agrícola Francisco Fernández Yépez (MIZA), Facultad de Agronomía, Universidad Central de Venezuela, Aragua, Venezuela
¤ Coordenação de Biodiversidade, Instituto Nacional de Pesquisas da Amazônia (INPA), Manaus, Brazil
« Laboratório de Sistemática e Biogeografia de Hemiptera, Departamento de Zoologia, Universidade Federal do Paraná (UFPR), Curitiba, Brazil
» Laboratório de Biologia Comparada de Insetos. Instituto de Biociências, Departamento de Zoologia, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, Brazil
Open Access

Abstract

Lamprosomatinae comprises ~250 species in 14 genera and four tribes, yet several Neotropical lineages remain poorly defined due to the absence of comprehensive morphological and molecular assessments. This study provides an integrative taxonomic reassessment of the closely related genera Dorisina, Lamprosoma, and Lychnophaes, including the description of two new species from Brazil. External and internal morphological characters of both sexes are documented with light and scanning electron microscopy, and updated biological information is presented, including host plant records, a newly documented parasitoid association, and distributional data. We also include observations on immatures and natural history traits. The first molecular dataset focused on Neotropical Lamprosomatinae is incorporated to evaluate generic limits and test the monophyly of the focal taxa. Our analyses reveal new insights into tribal-level relationships within Cryptocephalinae, supporting Fulcidacini + Pachybrachini and Clytrini + Cryptocephalini, while Mylassini forms a polytomy with the remaining groups. The monophyly of Lychnophaes could not be confirmed, as it is represented only by Lychnophaes imbirucu sp. nov. Conversely, Lamprosoma is recovered as monophyletic, with Lamprosoma cambuci sp. nov. clustering with two additional unidentified congeners. These results corroborate the relationships proposed by Chamorro and Konstantinov based on morphological data and reinforce the synapomorphies established for the tribe.

Keywords

Chrysomeloidea, Camptosomata, Lamprosomatini, Neotropical Region, Brazil, Phylogenetic insights

1. Introduction

The Lamprosomatinae comprise approximately 250 species across 14 genera and four tribes: Cachiporrini Chamorro & Konstantinov, 2011, Lamprosomatini Lacordaire, 1848, Neochlamysini Monrós, 1958, and Sphaerocharini Clavareau, 1913 (Chamorro 2014). Cachiporrini and Sphaerocharini each include only one genus from Brazil, while Neochlamysini contains two genera from the Afrotropical region.

Lamprosomatini is the most diverse tribe, with ten genera: Oomorphoides Monrós, 1956, distributed in the Indomalayan and Australasian regions; Lamprosoma Kirby 1818, Dorisina Monrós, 1956, Lamprosomatoides Monrós, 1958, Lychnophaes Lacordaire, 1848, and Oyarzuna Bechyné, 1950, endemic to the Neotropical region; Asisia Bezděk, Löbl & Konstantinov, 2010, and Scrophoomorphus Medvedev, 1968, endemic to the Indomalayan region; Xenoomorphus Monrós, 1956, restricted to the Afrotropical region; and Oomorphus Curtis, 1831, the only genus distributed across all biogeographical regions (Chamorro 2014; Chamorro and Konstantinov 2011; Monrós 1956, 1958, 1959, 1960; Seeno and Wilcox 1982).

According to Monrós (1956), among the Neotropical genera, three are relatively closely related: Dorisina, Lamprosoma, and Lychnophaes. The first was created for Monrós in 1956, only for allocating Lamprosoma pusillus Jacoby, 1890. The author indicated that other small species found in Central America also should be transferred to Dorisina. Despite their similarities, two characters are used to distinguish these three genera. First, Lamprosoma differs from the other two genera by possessing an appendiculate tarsal claw, whereas the other two genera have simple tarsal claws. Second, Dorisina can be distinguished from Lamprosoma and Lychnophaes by the presence of a deep fovea on the external ocular margin. Beyond these distinctions, no internal characters have been identified to further clarify the boundaries between these closely related genera, primarily due to the lack of comprehensive taxonomic revisions focused on Lamprosomatinae. Furthermore, morphology or molecular data have yet to be employed to test the monophyly of Lamprosoma, the genus that names the subfamily and comprises more than half of its species, or to elucidate the relationships among Neotropical genera.

In 2011, Chamorro and Konstantinov carried out the first phylogenetic analysis focused on Lamprosomatinae, based on morphological characters. Their study included 12 of the 14 recognized genera of the subfamily (Oyarzuna Bechyné, 1950 and Scrophoomorphus Medvedev, 1968 were not included), representing all four tribes. The main results supported the monophyly of Cryptocephalinae, with Fulcidacini and Clytrini as its tribes, and recognized Sphaerocharini as a distinct tribe within Lamprosomatinae. Five equally parsimonious trees and the consensus tree recovered Lychnophaes as the sister-group of (Dorisina + Lamprosoma), with the latter clade supported by homologous synapomorphies

Therefore, the present study aims to address open gaps in the systematics of Lamprosomatinae by describing new Brazilian species of Lamprosoma and Lychnophaes and providing detailed external and internal morphological descriptions, light microscopy and scanning electron microscopy images of both females and males, updated biological data, including records of host plants and associated parasitoids, and distribution maps. Additionally, this is the first study to incorporate molecular data to investigate the relationships among closely related Neotropical genera in the subfamily.

2. Material

For this study, specimens of Lamprosoma and Lychnophaes were collected in Paraná (Curitiba) and Minas Gerais (Aiuruoca) states. Addition material, deposited in the Padre Jesus Santiago Moure Collection, Universidade Federal do Paraná was examined: Lamprosoma alacre Caxambú & Almeida, 2003, Lamprosoma azureum Germar, 1824, Lamprosoma auricaudatum Monrós, 1956, Lamprosoma amethystinum Perty, 1832, Lamprosoma bicolor Kirby, 1818, Lamprosoma chamaeleon Lacordaire, 1848, Lamprosoma chrysopygium Germar, 1824, Lamprosoma corruscum Guérin-Méneville, 1844, Lamprosoma festivum Germar, 1824, Lamprosoma podtiaguini Monrós, 1947, Lamprosoma oblongum Lacordaire, 1848, Lamprosoma seraphicum Lacordaire, 1848, and Lamprosoma triste Guérin-Méneville, 1844 (see Table S1).

The pinned material is borrowed from the museums/collections listed below (curators between parentheses): CEIOC – Coleção Entomológica do Instituto Oswaldo Cruz, Rio de Janeiro, Brazil (Márcio Felix, Claudia L. Rodrigues). CEMT – Coleção Entomológica de Mato Grosso Eurides Furtado, Universidade Federal de Mato Grosso, Cuiabá, Brazil (Fernando Z. Vaz-de-Mello). DZUP – Coleção Entomológica Padre Jesus Santiago Moure, Universidade Federal do Paraná, Curitiba, Brazil (Lúcia Massutti de Almeida). INPA – Instituto Nacional de Pesquisas da Amazônia.

3. Methods

Larvae and adults of a new species of Lamprosoma were hand-collected at Sítio Anagi Cambuci, Aiuruoca, Minas Gerais, Brazil. The collection site encompasses agroforestry systems and areas adjacent to the Atlantic Forest. All specimens were observed feeding on Campomanesia phaea (O. Berg) Landrum (Myrtaceae Juss.), a plant native to the Atlantic Rainforest phytogeographic domain, in the Ombrophilous Forest (Rainforest) vegetation type and geographically distributed in south-eastern Brazil, in the states of Minas Gerais, Rio de Janeiro, and São Paulo, commonly known as “cambuci”. Adults of a new species of Lychnophaes were hand-collected in Pseudobombax grandiflorum (Cav.) A. Robyns (Malvaceae Juss.), in the Centro Politécnico campus, Universidade Federal do Paraná, Curitiba, Brazil.

Both new species were studied in the Laboratório de Semioquímicos (Universidade Federal do Paraná, Curitiba) for preliminary pheromone analysis. Due to the size and availability challenges associated with the host plant C. phaea, adults of the new Lamprosoma were lab-reared on Eugenia uniflora L. (Myrtaceae), a species widely distributed in South America: northeast (Sergipe, Alagoas, and Bahia), the entire southeast and south, and the center-west (Mato Grosso do Sul) and commonly known as “pitanga”. In contrast, the new Lychnophaes collected from Pseudobombax grandiflorum (Cav.) A. Robyns was lab-reared on its original host. Despite the large size of the tree, apical portions of leafy branches could be detached and offered in the laboratory.

Following the pheromone studies and their natural death, adults were processed for morphological examination. Specimens were dissected using forceps and stylets, with one entire body of a female and male of each new species initially boiled in distilled water and soap to soften tissues. Specific structures, such as genitalia, were further treated in 10% potassium hydroxide (KOH) to remove residual tissues posteriorly stored in a microtube with glycerin. The terminology used for the adult external morphology follows Monrós (1956) and Caxambú and Almeida (1999). Suzuki (1988) was used for sclerite interpretation.

Light microscopy photos of the external morphology were taken using a Leica M205A stereomicroscope equipped with a Leica DMC4500 digital camera, using LAS software (version 3.8), at the Coleção de Invertebrados, INPA. Images of the internal morphology of adults and external morphology of the immatures were captured using a Leica MZ16 stereomicroscope, a Leica DFC500 camera, the Leica LAS 3D viewer, and the LAS Montage Module version 4.7 software (Taxonline – UFPR). Scanning electron microscope (SEM) images were obtained at the Centro de Microscopia Eletrônica of the Universidade Federal do Paraná (CEMUFPR). Image editing was performed with specialized software. Photographs of the parasitoid wasp were taken using a Leica DFC295 camera attached to a Leica M125 stereomicroscope and stacked using Helicon Focus software (version 8.2.0) at the Laboratório de Biologia Comparada de HymenopteraUFPR.

Geographic distribution that has already been published (Caxambú and Almeida 1999, 2003; Lacordaire 1848; Monrós 1948a, b, 1949, 1956, 1958, 1959, 1960) and new records are presented (see Table S1). Biogeographical regionalization follows Morrone et al. (2022). Distribution maps were prepared from locality data on specimen labels and in the literature. Geographical coordinates were obtained from Google Earth Pro 7.1, and the map was generated with SimpleMappr (Shorthouse 2010) and edited in Photoshop CS2.

Records of host plants were obtained from specimen labels and the literature. Current nomenclature of host plants was verified using Flora e Funga do Brasil, the Catalogue of Life, and the USDA PLANTS Database.

For the data of the series-type material examined, the labels were copied verbatim, and semicolons (;) separate different labels, backslashes (|) separate different lines on the same label, and text within square brackets [ ] is ours.

4. Molecular analysis – taxon sampling

Our data matrix comprises 19 terminal taxa, including two newly sequenced in this study and 17 previously available in GenBank. Nine species of Lamprosomatinae (Lamprosomatini) were designated as the internal group, while eight species of Cryptocephalinae (Clytrini, Cryptocephalini, Fulcidacini, Mylassini, and Pachybrachini tribes) and two species of Eumolpinae (Eumolpini) were assigned to the outgroup (see Table S2). All 19 species belong to the Eumolpinae clade (Gómez-Zurita et al. 2007; Nie et al. 2020).

4.1. Molecular analysis – DNA extraction and sequencing

We use the hind leg of the two new species of Lamprosomatinae for DNA extraction, employing Proteinase K (Cytiva) and Sodium Dodecyl Sulfate (SDS). DNA was isolated from the lysate using Solid-Phase Reversible Immobilization (SPRI) with Sera-Mag SpeedBeads Carboxylate-Modified Magnetic Particles (Cytiva) following Uhlen (1989). DNA was preserved in TE buffer (10 mM Tris, 0.1 mM EDTA) and quantified using a NanoDrop 2000/2000c spectrophotometer (Thermo Fischer Scientific).

Polymerase chain reactions (PCRs) were performed with Taq DNA Polymerase (Ludwig) following the manufacturer's adapted protocol: ~17 μL ddH2O, 3 μL MgCl2, 2.5 μL 10 × MgCl2 buffer, 1–3 μL DNA template (15–25 ng/μL), 0.3 μL forward and reverse primer (10 pmol), 0.4 μL dNTPs (25 mM), and 0.2 μL Taq. PCR products were verified using 1.5% agarose gel electrophoresis in TBE 1 × (tris-borate-edta buffer).

Cytochrome Oxidase subunit I (COI) was amplified using dgHCO, dgLCO primers (5'-GGTCAACAAATCATAAAGAYATYGG-3' / 5'-TAAACTTCAGGGTGACCAAARAAYCA-3'; Meyer 2003), with the following method: 95 °C 3 min followed by 40 cycles of 95 °C for 30 s, 49 °C for 40 s, and 72 °C for 1 min, and a final elongation time of 10 min. 12S ribosomal DNA (12SrDNA) was amplified using dg12sbi / 12sai primers (5'-ARAGCGACGGGCRATRTGT-3' / 5'-AAACTAGGATTAGATA CCCTATTAT-3'; modified from Simon e al. 1994) with the following method: 95 °C 3 min, followed by 40 cycles of 95 °C for 30 s, 54 °C for 40 s, and 72 °C for 1 min, and a final elongation time of 10 min. PCR reactions were also performed targeting the 18S, 28S, and 16S genes. Following the standard protocols, we performed protocols for such genes using: dg16Sb (5'CCGGTY TGAACTCAGATCAYGT3') along dg16Sar (5'CGCCTGTTTAWCAAAAACAT3'), 18Sb5.0 (TAACC GCAACAACTTTAAT3') along dgCV7r (5'GATTCCTTCAGTGTRGCGCGCGTG3') and 28S-01 (5'GACTACCCCCTGAATTTAAGCAT3') along 28SR-01 (5'GACTCCTTGGTCCGTGTTTCAAG3'). However, despite our efforts, we were unsuccessful in amplifying these regions. Nevertheless, these genes were still considered in the phylogenetic analysis due to their relevance and importance in reconstructing evolutionary relationships.

PCRs were purified via SPRI with Polyethylene Glycol 8000 (PEG 8000) following protocols from DeAngelis et al. (1995), Hawkins et al. (1994), and Lis and Schleif (1975). We used BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) under standard protocols for the sequencing reactions. Sequencing was performed in both forward and reverse directions using POP-7 Polymer for 3500/SeqStudio Flex, followed by elution in Hi-Di Formamide and analysis on a 3500xL Genetic Analyzer (Applied Biosystems).

4.2. Molecular analysis – phylogeny

Contigs were produced and edited using BioEdit (Hall 1999). Primer regions were trimmed from the ends of the concatenated sequences, thus avoiding possible reading mistakes. Sequences were aligned using MAFFT v7 (Katoh et al. 2019). After alignment, all sequences were double-checked to identify possible alignment errors. The sequences were then concatenated using SequenceMatrix (Vaidya et al. 2011). The voucher and NCBI sequence accession number can be found in Table S3.

Bayesian phylogenetic reconstruction (BI), using MrBayes 3.2.7, and a Maximum Likelihood (ML) and bootstrap analyses, using IQ-TREE (Nguyen et al. 2015), were performed in the PhyloSuite v1.2.3 software (Zhang et al. 2020; Xiang et al. 2023). We constructed our matrix with a partition of five blocks, corresponding to each molecular marker: 12S (866 nucleotides), 16S (1392), 18S (1971), 28S (1232), and COI (1543). The Markov Chain Monte Carlo (MCMC) for the Bayesian analyses was run with a number of 5 × 106 generations. Default MrBayes priors were used, except for the implementation of a mixed evolutionary model of nucleotide substitution, ratepr set to variable, and temperature set to 0.05. Chain convergence was assessed in Tracer 1.7.1 (EES > 400; Rambaut et al. 2018) and 25% of trees obtained prior to convergence were discarded as burn-in. The clade support of the Maximum Likelihood analyses was measured through 10000 ultrafast bootstrap replicates. For the ML Analyses, ModelFinder v2.2.0 (Kalyaanamoorthy et al. 2017) was used to select the best-fit partition model (Edge-unlinked) using the AICc criterion. The best-fit model according to AICc was: GTR+F+G4: 12S, GTR+F+I+G4: 16S, GTR+F+I: 18S, GTR+F+I+G4: 28S, GTR+F+I+G4: COI. The final trees were visualized in FigTree v1.4.4 (Rambaut 2016) and edited in Adobe Illustrator CC.

5. Results

5.1. Phylogeny

Our data matrix contained 19 terminal taxa, two of them newly sequenced here and nine of which corresponding to species of Lamprosomatinae. The final concatenated alignment for the six molecular markers (12S, 16S, 18S, 28S and COI) resulted in a total of 7,004 base pairs.

Both Bayesian (BI) and Maximum Likelihood (ML) methods recovered a highly similar tree topology. High support values (>98% in Bayesian posterior probabilities and > 95 bootstrap values) were recovered in both BI and ML analyses. In both BI and ML trees, Lychnophaes and Lamprosoma were recovered as a sister-groups, and this clade sister to Oomorphoides. The relation of Lychnophaes and Lamprosoma were highly supported in both analyses, as well as the relation of this clade with Oomorphoides.

Major differences between BI and ML analyses can be found in the relation of outgroups, as Fulcidacini being recovered as sister of the remaining Cryptocephalinae in the ML and as sister to Pachybrachini in the BI. Additionally, the BI analysis recovered a polytomy at the base of Cryptocephalinae between Mylassini, the clade (Fulcidacini+Pachybrachini), and the clade (Cryptocephalini + Clytrini) (Fig. 1).

Figure 1. 

Phylogenetic relationships among species of Lamprosomatinae (Coleoptera, Chrysomelidae) resulting from a Bayesian Inference of concatenated data set of 7,004 aligned nucleotides, from the following six gene loci: 12S rDNA; 16S rDNA, 18S rDNA, 28S rDNA and cytochrome oxidase subunit 1, COI. General Bayesian posterior probabilities values of each node are highlighted.

5.2. Taxonomy history of Lamprosoma

The genus Lamprosoma (Lamprosomatinae: Lamprosomatini) was described by Kirby in 1818 (Trans. of the Linnean Society XII, p. 445) to accommodate species previously described in Eumolpus Weber, 1801, and Chrysomela Linnaeus, 1758. Kirby considered these species to have stronger affinities with Clytra than with the genera in which they had originally been described; nevertheless, despite this resemblance, they differed from Clytra in the structure of the labrum, mandibles, and palpi, as well as in their more globular body shape (Kirby 1818). Subsequent descriptions, such as those by Germar (1824), added species from Brazil, including La. auricharorum, La. festivum, La. chrysopygium, and La. azureum. Twenty-four years later, Lacordaire (1848), until now the biggest work for Lamprosoma, in the section “Lamprosomidées”, defined Lamprosoma with the following morphological characteristics: “Point de pygidium. Crochets des larses appendiculés. Palpes médiocrement épais. — Articles 3–5 des antennes non transversaux, très-faiblement et obtusément dentés intérieurement. — Prothorax non anguleux sur ses côtès, toujours très-fortement lobé et jamais crénelé à sa base. — Ecusson très-petit ou très-obus, en triangle trèsaigu. — Lobes des épipleures des élytres petits, anguleux et brusquement formés.— Abdomen plane en dessous; son bord postérieur crénelé. — Dernier article des tarses médiocrement allongé.”

This characterization applies almost fully to both Lamprosoma and Lychnophaes, with the appendiculate tarsus, present only in Lamprosoma, being the sole morphological character distinguishing them.

Throughout the mid-20th century, Monrós (1948a, b, 1956, 1960) expanded the taxonomic scope of Lamprosoma, describing 11 new species, three of which occur in Brazil, and developing a species-level identification key. He later estimated the genus to include 128 species, with 54 occurring in Brazil (Monrós 1960).

After a period of taxonomic stasis, Caxambú and Almeida (2003) attempted to revise the South American species of Lamprosoma but were ultimately unsuccessful. This was primarily due to the unavailability of most type specimens, including those described by Germar and Lacordaire. Several types could not be located in the collections, for example, Lamprosoma azureum and La. chrysopygium, both described by Germar, are not present in the Zoologisches Museum der Humboldt-Universität. Other specimens were withheld by curators who were unwilling to loan the material to Brazil (Caxambú and Almeida 2003). Consequently, out of the 128 species described for the genus, only seven were redescribed – La. amethystinum Perty, 1832, La. azureum Germar, 1823, La. bicolor Kirby, 1818, La. chrysopygium Germar, 1823, La. corruscum Guérin-Méneviile, 1844, La. podtiaguini Monrós, 1947, and La. triste Guérin-Méneviile, 1844 – and one species was described as new, La. alacre Caxambú & Almeida, 2003. Despite the limited number of species studied, given the taxonomic impediment encountered by the authors, their work represents the first and only study, until now, that includes color images, figure plates of the female and the male genitalia, and a key to the species.

Within the genus, another significant gap is the scarcity of information regarding host plants, few species have known plant records, namely: La. acaciae on Acacia spp., Fabaceae Lindl. (Mimosoideae (R.Br.) DC.) (Monrós 1948), La. amethystinum collected on Terminalia catappa L., Combretaceae R.Br. (Casari and Teixeira 2008), La. azureum collected on Psidium cattleianum Sabine, Myrtaceae (Caxambú and Almeida 1999), La. bicolor on T. catappa L., Combretaceae (Moreira 1913), La. chorisiae collected on Chorisia speciosa and C. insignis (A. St. -Hil., A. Juss. & Cambess.), Bombacaceae (Monrós 1949), La. seraphicum, collected on T. hassleriana Chod., Combretaceae (Fiebrig 1910) and Melastomataceae was already being registered for the genus (Caxambú 1998) (see Table S1).

Despite being the most diverse genus in the subfamily and consuming some species of economic importance, biological data on Lamprosoma is scarce, and the types and morphology, including both the female and the male genitalia, continue to be mostly unknown.

5.3. Descriptions

Class Insecta Linnaeus, 1758

Order Coleoptera Linnaeus, 1758

Suborder Polyphaga Emery, 1886

Infraorder Cucujiformia Lameere, 1938

Superfamily Chrysomeloidea Latreille, 1802

Family Chrysomelidae Latreille, 1802

Subfamily Lamprosomatinae Lacordaire, 1848

Tribe Lamprosomatini Lacordaire, 1848

Lamprosoma Kirby, 1818

Kirby 1818: 445 (genus description); Lacordaire 1848: 574 (species description, distribution); Kirby and Spence 1865: 262 (larval case); Girard 1873: 775 (natural history); Chapuis 1874: 216 (catalog); Jacoby 1880: 90 (catalog); Weise 1882 (species description), Jacoby 1908 (species description); Fiebrig 1910: 236 (illustrated description of larva, host plant); Moreira 1913 (natural history); Achard 1914 (catalog); Böving and Craighead 1930: 64 (key to the larvae of the subfamily); Chen 1940 (species description); Chevrolat 1842 (catalog); Blackwelder 1946 (catalog); Monrós 1948b: 81 (species description); Monrós 1949 (natural history, immature description); Fiori 1951: 183 (case construction); Monrós 1956: 59 (revision of tribes, distribution, figures); Monrós 1960: 9 (catalog); Ogloblin and Medvedev 1971: 41 (illustration); Linsenmaier 1972: 158 (illustrations of egg and larval cases); Kasap and Crowson 1976: 100 (citation); Erber 1988: 143 (citation); Reid 1995: 82–84 (morphological characters); Caxambú and Almeida 1999: 244 (immature description, species redescription); Caxambú 1998: 1–65 (biology); Wikler et al. 1999: 660 (biology, host plant, fecal case); Jolivet and Verma 2002: 50, 501 (host plant); Caxambú and Almeida 2003: 330 (species description, species redescription, key); DalMolin 2005: 7 (pest); Casari and Texeira 2008: 39 (illustrated descriptions of larva and pupa); Chamorro 2014: 226 (tribe description); Chaboo et al. 2016 (immature catalogue); Agrain et al. 2017 (Camptosomata of Argentina).

Type species.

Lamprosoma bicolor Kirby, 1818: 445. By original monotypy.

Lamprosoma cambuci Santos, Jorge & Zarbin, sp. nov.

Figures 2, 3, 4, 5, 6, 12

Diagnoses.

The species has an oval body in dorsal view, strongly convex dorsally and flat ventrally (Fig. 2A, B). The head, pronotum, and elytra are matte, iridescent blue (Fig. 2A–H), while the mouthparts, antennae, legs, and abdomen are bluish black. The prosternal process is longer than wide and gently constricted in the middle in females. The last abdominal ventrite is larger than the previous three; in females, it presents a concavity densely punctate and covered with setae, while in males, it bears a concentrated tuft of setae medially at the apex. The apical margin of the dorsal genital valve uniformly slender (Fig. 6D), bearing short and thick setae. Dorsal valve medially projected. Dorsal sclerites paired, elongated, curved to follow the contour of the ventral wall. Ventral sclerites paired, elongated, reaching the median portion of the aedeagus, apically sinuous. Sclerite in the basal region possibly homologous to the ejaculatory hook (Fig. 6A–C). Single spermatheca, without chamber formation (Fig. 6E). A large chitinous cushion (chitinpolster) present, with lateral folds widened, bending upwards and posteriorly extended into a longitudinal twig, median fusion of the lateral folds of the chitinpolster, forming an H-like structure. Styli present and fused. Spermathecal ducts intricate.

Figure 2. 

External morphology of the male of Lamprosoma cambuci Santos, Jorge & Zarbin sp. nov. A Dorsal view; B ventral view; C frontal view; D lateral view.

Figure 3. 

External morphology of the female of Lamprosoma cambuci Santos, Jorge & Zarbin sp. nov. A Dorsal view; B ventral view; C frontal view; D lateral view.

Figure 4. 

Scanning electron microscope (SEM) images of the external morphology of the male of Lamprosoma cambuci Santos, Jorge & Zarbin sp. nov. A dorsal view; B pronotum with reception sensilla; C lateral view; D lateral view of the pronotum showing both “boss”; E frontal view; F first antennal articles; G ventral view; H last abdominal ventrite serrated and corresponding to the equivalent serration on the internal surface of the elytra (elytral lock mechanism); I appendiculate claws.

Figure 5. 

Scanning electron microscope (SEM) of the external morphology of the female of Lamprosoma cambuci Santos, Jorge & Zarbin sp. nov. A Dorsal view; B pronotum with reception sensilla; C frontal view; D two distal antennomeres; E ventral view; F last abdominal ventrite serrated and corresponding to the equivalent serration on the internal surface of the elytra (elytral lock mechanism).

Figure 6. 

Male and female genitalia of Lamprosoma cambuci Santos, Jorge & Zarbin sp. nov. A Ventral view of the aedeagus; B ventrolateral view of the aedeagus; C lateral view of the aedeagus; D apical view of the aedeagus; E female genitalia.

Description.

MALE: Body. Oval, strongly convex dorsally and flat ventrally (Fig. 2A, B). — Integument color. Head, pronotum, and elytra lead blue (Fig. 2A, B), with violaceous reflections; ventral surface, including legs and abdomen, dark blue. Elytra with ten rows of punctures extending from the base to the apex, where they merge. In dorsal view, only eight rows are visible. Each puncture with a short, yellowish hair. — Head. Frons with fine punctures, evenly distributed (Figs 4, 5A–E). Head anteriorly flat, with very slight, rounded impression in the interocular space in the males (Fig. 2C). Eyes emarginated at the level of antenna insertion. Antennae (Figs 2B, 4F) short, with eleven segments, inserted between the base of the eye and lateral edges of the clypeus. Labrum short, sub quadrangular, with angulate lateral margins. — Prothorax. Pronotum convex, narrower than the base of elytra, sinuous at base, with fine punctures like those on frons in the posterior region and coarser in the anterior region; prosternal process longer than wide (Figs 2B, 4E–G), sinuous medially, and truncated at apex. — Meso- and metathorax. Mesothorax small, with triangular scutellum, with acute apex (Fig. 2A). Epipleura narrow. Elytral apex with the inner surface bearing a depression that receives the denticles on the apex of the last ventrite, forming an elytral locking mechanism. Prosternal process narrow and length than width. Anterior legs (Fig. 2B, D) with femora with the inner margin project into the median portion, tibiae with a small tooth-like in the internal and external portion apex. Four visible tarsomeres; the last tarsomere protrudes less than one-third of the anterior tarsal lobe, with an appendiculate claw (Fig. 4I). Middle and Posterior legs (Figs 2B, 4G) similar to the anterior leg, except for the transverse coxae and femora lack internal projections. — Abdomen. with five ventrites, the last serrated at the apex (elytral lock mechanism) (Fig. 4H). Ventrite I with lateral arc-shaped depressions to receive the metafemora (Figs 2B, 4G); Ventrite II to IV medially punctate and with short setae, ventrite V more densely punctate and with long setae. — Aedeagus (Fig. 6A–D). Apical margin of the dorsal valve uniformly slender, bearing short and thick setae. Dorsal valve medially projected. Apical sclerites paired, elongate, curved to follow the contour of the ventral wall. Median sclerites paired, elongate, reaching the median portion of the aedeagus, apically sinuous. Sclerite in the basal region possibly homologous to the ejaculatory hook. — FEMALE (Figs 3A–D, 5A–F, 6E): Head anteriorly flat, with a very strongly, roundly impressed on the interocular space (Figs 3C, 5C, 5E). Prosternal process length than width (Figs 3B, 5E). Abdominal ventrite V more strongly punctate and densely pilose than in males. One single spermatheca (Fig. 6E), without chamber formation, hook-shaped. A large chitinous cushion (chitinpolster) present, with lateral folds widened, bending upwards and posteriorly extended into a longitudinal twig, median fusion of lateral folds of the chitinpolster, forming an H-like structure. Styli present and fusion. Spermathecal ducts intricate.

Egg case.

Brownish, host plant’s wood fibers visible, with three vertical rows of externally projecting spicules surrounding the entire case, forming a total of seven vertical lines of spicules (Fig. 12J, L, K).

Larval case.

Brownish, “bonnet Phrygian”-like; host plant’s wood fibers visible (Fig. 12C, E, F).

Host plants.

Campomanesia phaea (O. Berg) Landrum (Myrtaceae).

Parasitoid.

Undetermined wasp species belonging to Brasema Cameron, 1884 (Hymenoptera: Chalcidoidea: Eupelmidae) (Fig. 14A–F).

Geographical distribution.

Brazil: Minas Gerais, Aiuruoca (Fig. 11).

Type series.

The type series of the new species of Lamprosoma comprises 13 specimens: the holotype (male) and five paratypes (♀ and ♂), being the holotype and three paratypes deposited in the DZUP, along with the parasitoid wasp (a single individual that emerged from a pupal case), while two paratypes (one ♀ and one ♂) were deposited in the Invertebrate Collection of the Instituto Nacional de Pesquisas da Amazônia – INPA. Seven paratypes (♀ and ♂) that were used in the molecular extraction and in the scanning electron microscope (SEM) images were also deposited in the DZUP and INPA. — DZUP. Holotype ♂ labeled: BRASIL: Minas Gerais, Aiuruoca,| Sítio Angai Cambuci.| 28.VIII.2024| Col. Thiago Nicoliello, 2024; Consumindo Campomanesia phaea| (O. Berg) Landrum| Nome popular: Cambuci.; HOLOTYPE| Lamprosoma cambuci| Santos, Jorge & Zarbin, 2025; DZUP| 325202. — One paratype ♀ and two paratypes ♂ labeled: BRASIL: Minas Gerais, Aiuruoca,| Sítio Angai Cambuci.| 28.VIII.2024| Col. Thiago Nicoliello, 2024; Consumindo Campomanesia phaea| (O. Berg) Landrum| Nome popular: Cambuci.; PARATYPE| Lamprosoma cambuci| Santos, Jorge & Zarbin, 2025; DZUP| 325199; 325200; 325201. Used in molecular and MEV analyses: Three ♀ and three ♂ labeled: BRASIL: Minas Gerais, Aiuruoca,| Sítio Angai Cambuci.| 28.VIII.2024| Col. Thiago Nicoliello, 2024; Consumindo Campomanesia phaea| (O. Berg) Landrum| Nome popular: Cambuci.; PARATYPE| Lamprosoma cambuci| Santos, Jorge & Zarbin, 2025| Det. A.T. dos Santos, 2024; DZUP| 325186; 325187; 325188; 325189; 325190; 325191; 325192; 325193. — INPA. One paratype ♀ and one paratype ♂ labeled: BRASIL: Minas Gerais, Aiuruoca,| Sítio Angai Cambuci.| 28.VIII.2024| Col. Thiago Nicoliello, 2024; Consumindo Campomanesia phaea| (O. Berg) Landrum| Nome popular: Cambuci.; PARATYPE| Lamprosoma cambuci| Santos, Jorge & Zarbin, 2025; INPA-COL|002861; INPA-COL 002862.

Etymology.

The specific name “cambuci” is used in apposition and was chosen based on the common name of the host plants consumed by the species. The term cambuci originates from the Tupi-Guarani Indians and means “pot of water,” referring to the vase-like shape of the fruit. According to Navarro (2013), the Tupi-Guarani term kamu’si denotes a vase or a funerary urn used by the Tupis.

Remarks.

This species belongs to the “D2A” group delimited by Lacordaire (1848) (see Table S1). This species closely resembles Lamprosoma azureum in terms of its external morphology, particularly coloration. These species exhibit a uniform blue dorsal surface without additional spots. In both species, the dorsal surface is a matte and iridescent blue. The ventral sclerites are paired and elongate, extending to the median portion of the aedeagus, a trait shared by La. azureum and La. cambuci. We thus regard them as likely sister species.

Differences between the two include the following: the ventral apical margin of the ventral valve is laterally thickened in La. azureum, while in La. cambuci it is uniformly slender, with short and thick setae present in both species. In L. cambuci, these sclerites are apically sinuous, whereas in La. azureum, the sclerites follow the curvature of the ventral wall. The dorsal sclerite is found exclusively in La. cambuci. The dorsal valve is medially projected in both species. The sclerite in the basal region is possibly homologous to the ejaculatory hook, present in both species. The female has a large chitinous cushion (chitinpolster) present, with lateral folds widened, bending upwards and posteriorly extended into a longitudinal twig, resembling Lamprosoma sp. as mentioned by Schöller (2008), except for the median fusion of the lateral folds of the chitinpolster, forming an H-like structure.

Lychnophaes Lacordaire, 1848

Lacordaire 1848: 574 (genus and species description); Chapuis 1874: 218 (catalog); Achard 1914:4 (catalog); Blackwelder 1946: 650 (catalog); Monrós 1956: 59 (revision of the tribe, figures); Monrós 1960: 9 (catalog).

Type species.

Cryptocephalus globulosus Olivier, by subsequent designation by Achard, 1914.

Taxonomical history of Lychnophaes.

Following Lacordaire (1848), the species belonging to the Lychnophaes are easily distinguished due to the variety of colors found in the few species known, and for the Lamprosoma due to the no appendiculate claws. The nine species that were studied by Lacordaire one distributed in Brazil, five from French Guiana, one from both localities, and the last two from Colombia. Besides the color, Lacordaire divided the species into two groups based on the ocular margin. The first one was defined by the “Eyes triangularly emarginated in the lower half” and comported Lychnophaes laticollis, Ly. globosus, Ly. cornutus, while the second group was defined as “Eyes quadrangularly emarginated in the lower half”, and the following species belong to them: Ly. principalis, Ly. pilula, Ly. empyreus, Ly. hypochrysus, Ly. purpureus and Ly. cyaniceps.

Only two specimens of Lychnophaes principalis (Lacordaire, 1848) were deposited in the collection of Pe. Jesus Santiago Moure. However, the two differences observed by Lacordaire: deeply notched eyes in the lower half and triangular eyes, and slightly notched below the middle, were not observed in our material. The study of other species of the genus may better interpret this characteristic.

Lychnophaes imbirucu Jorge, Santos & Zarbin, sp. nov.

Figures 7, 8, 9, 10

Diagnoses.

Eyes emarginate. Scutellum tiny. Elytra covering the pygidium. The last abdominal ventrite serrated like the inner surface of the elytra (closing mechanism). Tibiae flattened. Fore and middle legs with simple claws and the hind leg with appendiculate claws.

Description.

MALE: Body. Oval, strongly convex dorsally and flat ventrally (Figs 6, 7, 8). — Integument color. Head and pronotum coppery with yellowish green reflections and elytra cyan with green reflections; ventral surface, including abdomen, dark blue; legs cyan except anterior femur with green reflections (Fig. 6). — Head. Frons with fine punctures (Figs 6C, 7C). Head anteriorly flat (Figs 6D, 7B–D). Eyes emarginated at the level of antenna insertion (Figs 6B, 7C). Antennae short, with eleven articles, inserted between the base, eye, and lateral edges of the clypeus (Fig. 7C). Labrum short, transversal, narrower than the clypeus, bearing small thick setae (Fig. 7C). — Prothorax. Pronotum convex, narrower than base of elytra, sinuous posterioly, with fine punctures like those on frons anteriorly and coarser posteriorly (Figs 6A, 7A); longer than wide, sinuous medially and with a truncated apex. — Mesothorax and metathorax. mesothorax small, scutellum with extremely acute apex (Figs 6A, 7A). Elytra with ten rows of punctures extending from the base to the apex, where they merge. In dorsal view, only eight rows are visible. Each puncture with a short seta. Epipleura narrow, with a notch for the posterior femur (Figs 6B, 6D, 7B). Fore legs with femur without the inner margin projecting into the median portion, tibia without a small tooth-like in the internal and external portion apex (Figs 6B, 7B, 7D). Four visible tarsomeres (Figs 7D, 7E); the last tarsomere protrudes less than one-third of the anterior tarsal lobe, with simple claws except for appendiculate claws in posterior legs (Fig. 7E). Middle and posterior legs similar to anterior leg (Fig. 7D), excepted for the transverse coxa. — Abdomen with five ventrites (Figs 6B, 7D), the last serrated at apex (elytral lock mechanism) (Fig. 7F). Ventrite I with arc-shaped lateral depressions to receive metafemora; ventrites II to V medially punctate and with short setae. — Aedeagus (Fig. 9A–D): Dorsal valve articulated, rounded at apex. Ventral margin thickened laterally, with a deep lateral emargination. — FEMALE: Similar coloration to male except for lacking metallic green spot on the profemur. In the type series, there is a single entirely coppery female with reddish reflections instead of having blue elytra as in the others (Fig. 6E). Sternite VIII membranous, straight, without an apodeme. Genitalia (Fig. 9E) with a circular chitinpolster, resembling Oomorphoides tonkinensis as mentioned by Schöller (2008). Styli present and articulate. Spermatheca composed of three chambers connected. Duct non-sclerotized.

Figure 7. 

Lychnophaes imbirucu sp. nov. Male AD: A dorsal view; B ventral view; C frontal view; D lateral view. Female: E ventral view.

Figure 8. 

Lychnophaes imbirucu sp. nov. female variations. A, B: dorsal view; CE: dorsolateroposterior view.

Figure 9. 

Scanning electron microscopy (SEM) of the external morphology Lychnophaes imbirucu sp. nov. Male AF: A dorsal view; B lateral view; C head; D ventral; E posterior tarsus with appendiculate claw; F last ventrite serrated and correspondence in internal surface of elytra (elytral lock mechanism). Female GI: G ventral; H posterior tarsus with appendiculate claw; I last ventrite serrated and correspondence in internal surface of elytra.

Figure 10. 

Male and female genitalia of Lychnophaes imbirucu sp. nov. AD Male aedeagus: A ventral view; B ventrolateral view; C lateral view; D apical portion; E female genitalia.

Egg case.

Coverage without specific format.

Larval case.

Oval shape made up of earthy-looking material.

Host Plants.

Pseudobombax grandiflorum (Cav.) A. Robyns.

Parasitoids.

Unknown.

Geographical distribution.

Brazil: Paraná, Curitiba (Fig. 11).

Figure 11. 

Geographic distribution of Lamprosoma Kirby and Lychnophaes Lacordaire founded in the literature, plus the L. cambuci sp. nov. and L. imbirucu sp. nov.

Type series.

The type series of the new species of Lychnophaes comprises: the holotype and 20 paratypes, with the holotype and 18 paratypes deposited in the DZUP, and two paratypes (one ♀ and one ♂) deposited in the INPA. Seven paratypes (♀ and ♂) that were used in the molecular extraction and in the scanning electron microscope (SEM) images were also deposited in the Padre Jesus Santiago Moure Entomological Collection, totalizing 28 specimens. — DZUP. Holotype ♂ labeled: BRASIL: Paraná, Curitiba, Jardim| das Américas, Campus Jardim| Botânico, UFPR, 10.XII.2024,| Col. Isaac R. Jorge, 2024; Consumindo Pseudobombax grandiflorum| (Cav.)| A. Robyns; HOLOTYPE| Lychnophaes imbirucu| Jorge, Santos & Zarbin, 2025; DZUP| 325205. — Two paratypes ♂ and four ♀ labeled: BRASIL: Paraná, Curitiba, Jardim| das Américas, Campus Jardim| Botânico, UFPR, 10.XII.2024,| Col. Isaac R. Jorge, 2024; Consumindo Pseudobombax grandiflorum| (Cav.)| A. Robyns; PARATYPE| Lychnophaes imbirucu| Jorge, Santos & Zarbin, 2025; DZUP| 325206; 325208; 325209; 325210; 325711; 325712. One paratypes ♂ and seven ♀ labeled: BRASIL: Paraná, Curitiba, Jardim| das Américas, Campus Jardim| Botânico, UFPR, 01.XI.2023,| Col. Isaac R. Jorge, Aluska T. Santos; Consumindo Pseudobombax grandiflorum| (Cav.)| A. Robyns; PARATYPE| Lychnophaes imbirucu| Jorge, Santos & Zarbin, 2025; DZUP| 325255; 325253; 325254; 325256; 325257; 325258; 325259; 325260. One paratypes ♂ and three ♀ labeled: BRASIL: Paraná, Curitiba, Jardim| das Américas, Campus Jardim| Botânico, UFPR, 01.XI.2023,| Col. A.T. Santos & Isaac R. Jorge, 2023; Consumindo Pseudobombax grandiflorum| (Cav.)| A. Robyns; PARATYPE| Lychnophaes imbirucu| Jorge, Santos & Zarbin, 2025; DZUP| 325261; 325262; 325263; 325264. One ♀ and one ♂ labeled: BRASIL: Paraná, Curitiba, Jardim| das Américas, Campus Jardim| Botânico, UFPR, 10.XII.2024,| Col. Isaac R. Jorge, 2024; Consumindo Pseudobombax grandiflorum| (Cav.)| A. Robyns; Lychnophaes imbirucu| Jorge, Santos & Zarbin, 2025| Det. I.R. Jorge and A.T. dos Santos, 2024; DZUP| 325194; 325195; 325196; 325197; 325198; 325203; 325204. — INPA. One paratype ♀ and one ♂ labeled: BRASIL: Paraná, Curitiba, Jardim| das Américas, Campus Jardim| Botânico, UFPR, 10.XII.2024,| Col. Isaac R. Jorge, 2024; Consumindo Pseudobombax grandiflorum| (Cav.)| A. Robyns; PARATYPE| Lychnophaes imbirucu| Jorge, Santos & Zarbin, 2025; INPA-COL 002863; INPA-COL 002864.

Etymology.

The specific name “imbirucu” is a name in apposition, and it was chosen based on the host plants consumed by the species. The common name “imbirucu” originates from Tupi-Guarani, “mbirusú” language, and it’s used to name the tree belonging to the Bombacaceae, P. grandiflorum (Cav.) A. Robyns.

Remarks.

Spermatheca composed of three chambers, whereas Ly. principalis Lacordaire, 1848, possesses only two (personal observation by Isaac R. Jorge). Presence of articulate styli. Sternite VIII significantly more membranous compared to L. cambuci.

The genus Lychnophaes is distinguished from Lamprosoma only by its simple rather than appendicular claws. Since it has appendiculate claws only on the hind legs, Ly. imbirucu represents an exception to the genus. Comparative morphology studies should be performed to better understand this character.

6. Natural history

Lamprosoma cambuci sp. nov. was found feeding on Campomanesia phaea (Myrtaceae), Sítio Anagi Cambuci, Aiuruoca, Minas Gerais, Brazil, while Lychnophaes imbirucu sp. nov. adults were collected on Pseudobombax grandiflorum (Cav.) A. Robyns (Malvaceae Juss.), Campus Centro Politécnico, Universidade Federal do Paraná, Curitiba, Brazil (Fig. 11). Both immature and adults cause damage to the branches (Fig. 12a), leading to branch death due to complete consumption and strangles the branch, preventing the passage of phloem.

Figure 12. 

Biological observations of Lamprosoma cambuci Santos, Jorge & Zarbin sp. nov. A Damage caused by larvae into Campomanesia phaea (O. Berg) Landrum (Myrtaceae); B adult consuming Eugenia uniflora L. (Myrtaceae); C different sizes of cases made by the larvae; D larvae of an unknown instar; E case adjacent to the damage to the host plant; F case showing the exit hole created by the Brasema sp.; G adults copulating; H different pairs of adults forming and copulating; I female laying an egg; JL eggs.

The distribution of La. cambuci sp. nov. corresponds to the region with the greatest representation for the genus to date, since the literature only deals with studies with restricted distribution, such as Central America (Jacoby 1880) and Argentina and the Brazilian Atlantic Forest (Monrós 1948a, b) (Fig. 11). However, Ly. imbirucu sp. nov. is distributed outside the Amazonian domain, unlike the other species of the genus.

Due to difficulties in obtaining C. phaea seedlings, another Myrtaceae species, Eugenia uniflora L., was brought to the laboratory to provide food for the emerged males and females of Lamprosoma cambuci. Heavy feeding by the adults was observed (Fig. 12B), despite E. uniflora not being their native host plant. This alternative host plant was offered for two reasons: first, C. phaea was unavailable, and secondly, to prevent adult starvation. Additionally, E. uniflora was not chosen randomly; in previous years, another Lamprosomatini species was observed feeding on this tree. Therefore, we aimed to provide them with a plant previously consumed by a related species within the same tribe.

Concerning the immature stages, no description is provided here because although several cocoons of various sizes were examined, the majority were already in advanced larval stages, likely pupae, and several adults emerged during transit from the field to the laboratory. Only one larva of undetermined instar remained (Fig. 12D), but due to the absence of its host plant, it died a few days after arriving at the laboratory. This suggests that while the adult is capable of feeding on an alternative host plant, the larva does not share the same ability.

However, in literature, one can find some observations of immatures. According to Monrós (1949), for example, the larvae stay all day in a given portion of the tree, but at sunset they start their forage if the day was sunny, but if it was a rainy day, the larvae stay quiet, and do not forage. In the material we received, it was observed that foraging occurs very close to where the larvae stay during the day (Fig. 12A, E), with intense feeding along the entire branch and no evidence of competition with other larvae, as they maintain a certain distance from each other on the infested plant.

After the pupal stage, all emerged adults fed on E. uniflora L. (a single individual did not emerge, originating from the cocoon where a parasitoid emerged, Fig. 14 A–F) (Fig. 12B), with intense foraging observed among both females and males (Fig. 12B). Initially, adults were kept isolated for pheromone studies, but after this period, they were placed in rearing boxes for copulation observation. All males attempted to mate with the available females (Fig. 12G), and it was observed that copulation was preceded by several attempts until the final insertion of the aedeagus and the prolonged presence of the male on top of the female (Fig. 12H). This was followed by prolonged male presence on top of the female (Fig. 12H). Although males remained mounted after copulation, this behavior did not prevent other males from approaching or even attempting to dislodge the mounted male to mate with the same female. A few days after copulation, some females were observed laying eggs (Fig. 12I), both in the area between nodes and near the lateral buds (Fig. 12J–L).

Figure 13. 

Biological observations of Lychnophaes imbirucu sp. nov. Jorge, Santos & Zarbin: A Eggs, damage caused by an adult of Ly. imbirucu to Pseudobombax grandiflorum (Cav.) E. Robyns; B, C freshly laid eggs; C mature eggs; D case with rupture after the emergence of the adult; E adults copulating, including the female specimen of variant coloration; F female laying an egg; G, H larval case; G lateral view; I dorsal view.

Figure 14. 

Female of Brasema sp. (Hymenoptera: Eupelmidae). A Habitus, dorsal view; B head, frontal view; C head and mesosoma, dorsal view; D head, lateral view; E Part of mesosoma and metasoma, lateral view; F wing.

Ly. imbirucu sp. nov., in turn, was found feeding on P. grandiflorum (Myrtaceae). Both immature and adults cause damage to the branches and leaf petioles (Fig. 12A). Adults were found at the Campus Politécnico of the Universidade Federal do Paraná, Curitiba, Paraná from November to December 2023 and 2024, and then collected and taken for laboratory observations together with their host plant.

During the period of 2023, numerous series containing larvae, pupae, and adults about to emerge were collected in the field (Fig. 12A–C), while in 2024, only adults were found. During both periods, it was possible to observe copulation among all collected individuals, including between individuals showing different color patterns (Fig. 12E). However, only in the period of 2024 was the laying of eggs carried out individually (Fig. 12F) and covered with the egg case produced by the mother (Fig. 12G–I).

7. Pheromone in Lamprosomatinae

The two Lamprosomatinae species described here were initially collected for pheromone studies. The La. cambuci sp. nov. was collected and sent to the Laboratory of Semiochemicals because it was causing damage to an important native crop within an agroforestry system. Generally, such systems do not use any chemical control that could be harmful to species, soil, or the environment in general, and crops are typically grown in association with other plants. In turn, the Ly. imbirucu sp. nov. was collected to conduct chemical investigations focused on this subfamily, given that in the related subfamilies Cryptocephalinae and Eumolpinae, there is only one pheromone study for each and a few studies on cuticular profiles conducted for both groups (Santos et al. 2023). In these subfamilies, males have been found to be the sex responsible for emitting the aggregation pheromone (López et al. 2022; M.E. Vieira Xavier, PhD thesis, Federal University of Alagoas, 2019).

In laboratory arena conditions, males were instantly attracted to females. Accordingly, males and females were placed in separate aeration systems for volatile collection, as well as in SPME-based analytical systems, and after analyses with both methods, specific compounds were detected only in the female extracts. At that point, we consulted the literature in search of molecules that could indicate similarity and phylogenetic affinity, as well as data on host plants and other biological information that could guide us toward the species identification. It was then that we encountered a taxonomic impediment for both species. When searching for their respective names, we discovered that both species were still unknown to science, preventing the continuation of the chemical ecology work and requiring us to undertake a taxonomic study.

Thus, concomitantly with the description of both species, studies aiming to elucidate the chemical ecology of La. cambuci and Ly. imbirucu is underway and will be published soon.

8. Parasitoidism in Lamprosomatinae

There is only one parasitoid species so far recorded to use Lamprosomatinae as host, the wasp Ichneumon adsciti Westwood, 1882 (Hymenoptera, Ichneumonoidea, Ichneumonidae) (Chaboo et al. 2016). In the material examined for the present work, only one parasitoid emerged (Fig. 14), a Brasema Cameron, 1884 wasp (Hymenoptera: Chalcidoidea: Eupelmidae). Nevertheless, no Lamprosoma semaphoront emerged from the parasitized cocoon (Fig. 14), indicating successful development of the parasitoid and complete mortality of the host.

The genus Brasema is found throughout the New World and China, with 53 species (Gibson 1995). In South America, the genus has been recorded in Argentina and Brazil. In Central America, it has been recorded in Mexico. The species within this genus are considered parasitoids of eggs, larvae, and pupae of various insect orders, including Coleoptera, Diptera, Hemiptera, Hymenoptera, Lepidoptera and Mantodea (Gibson 1995; UCD Community 2023), For Coleoptera, different Brasema species are associated with four different families: Brentidae, Buprestidae, Cleridae, and Curculionidae, plus the new record we present in this study for Chrysomelidae (Table S4).

That our single collected Brasema specimen can be described as follows: body dull to bright metallic green or bluish with some areas in mesoscutum (Fig. 14A); mesopleuron yellow, mesosoma similarly light-colored (Fig. 14A, C, E); metallic gold and part of legs bluish metallic and brown and protarsomeres whitish and brown (Fig. 14A, E). Head with setae varied in color and structure, usually whitish or translucent and sometimes lanceolate on face, but only rarely in dense band along inner and/or lower orbit (Fig. 14B–D). In frontal view head subcircular to slightly wider than high (Fig. 14B); in lateral view head flat meniscoidal to hemispherical or wedge-shaped (Fig. 14D); in dorsal view not distinctly transverse; torulos below of the middle line lower orbit (Fig. 14B); face with scrobal depression. Head with carinately margined, v-shaped scrobal depression extended about two-thirds distance to the anterior ocellus (Fig. 14C). Eye superficially bare (Fig. 14B–D) to conspicuously microsetose; inner orbits variedly convergent dorsally (Fig. 14C). Antenna with flagellum black, except, but rarely with some funicular segments light-colored (Fig. 14D); clypeus flat (Fig. 14B), and mandible tridentate.

Material examined. Female of Brasema labeled: BRASIL: Minas Gerais, Aiuruoca,| Sítio Angai Cambuci.| 28.VIII.2024| Col. Thiago Nicoliello, 2024; Brasema Cameron, 1884| (Eupelmidae)| Det. André L. Martins & Gary A. P. Gibson, 2025; Brasema sp.| CAMERON ♀| André L. Martins| Det. 6.I.2025; DZUP| 325713.

9. Discussion

Currently, Chrysomelidae is recognized as a monophyletic family (Bocak et al. 2014; Douglas et al. 2023; Gómez-Zurita et al. 2007; Gómez-Zurita et al. 2008; Lawrence et al. 2011; McKenna et al. 2015; Nie et al. 2020) with 12 subfamilies. Despite the monophyly of the family, the internal relationships remain incompletely solved, including among the so-called Camptosomata, including Cryptocephalinae (Clytrini, Cryptocephalini, Mylassini, Fulcidacini, and Pachybrachini), and Lamprosomatinae, the last being the focus of this work.

Crowson (1955) erected Clytrinae, which included Fulcidacini (cited as Chlamisini), Clytrini, Cryptocephalini, and Lamprosomatini as a tribe. However, forty years after Crowson’s work, Reid (1995) conducted a cladistic analysis using both adult and larval characters, elevating Lamprosomatini to subfamily status, confirming the earlier indication by Monrós (1949). The other three taxa remained within Cryptocephalinae as tribes. In the Reid work, two other important hypotheses were put forward: (1) The monophyly of Eumolpinae + (Lamprosomatinae + Cryptocephalinae) and (2) the indication that Sphaerocharitinae (known as Sphaerocharini and corrected by Reid to take the genitive stems of the nouns) belongs to Lamprosomatinae.

Farrel (1998) conducted the first extensive molecular study, and despite the focus on the Phytophaga, the Lamprosomatinae were not included. Nevertheless, Farrel and Sequeira (2004) improved the previous study by adding 11 new sequences, including Sagrinae, Spilopyrinae, and Lamprosomatinae. Their results supported the monophyly of Chrysomelidae, composed of two clades, with Lamprosomatinae and Cryptocephalinae as sister-groups, and Eumolpinae as the sister to both (Farrel and Sequeira 2004).

The first study to propose Chrysomelidae as consisting of three major lineages with strong support was by Gómez-Zurita (2007, 2008). Although Lamprosomatinae and Sagrinae were absent, the authors carried out a parsimony analysis using morphological data and placed Lamprosomatinae in the “Eumolpinae clade”, as a sister-group to Cryptocephalinae. In this study, Cryptocephalinae s.l. was found to be monophyletic, though the internal relationships were not resolved. These results, with Lamprosomatinae as a sister-group to Cryptocephalinae, were later recovered by Nie et al. (2020) and Zhang et al. (2022), with the following topology: Spilopyrinae + (Cassidinae + (Eumolpinae + (Lamprosomatinae + Cryptocephalinae))). Despite these studies, the monophyly of Lamprosomatinae was only indicated by Duckett et al. (2004), using only two genera, Lamprosoma and Oomorphoides.

Focused on Cryptocephalinae, we have the largest sample with molecular data from five genes (COI, rrnS, pabp1, ef1a and LSU) carried out by Gómez-Zurita and Cardoso (2021), giving support to five tribes in the subfamily (Clytrini, Cryptocephalini, Fulcidacini, Mylassini and Pachybrachini) and Lamprosomatinae as sister-group.

Douglas et al. (2023) aimed to understand the relationships of flea beetles (Galerucinae: Alticini) and the position of Aulacothorax. Using genomic data, both Maximum Likelihood and coalescent phylogenetic analyses revealed the following topology: Synetinae as sister to Cassidinae + Eumolpinae + Lamprosomatinae + Cryptocephalinae. They also conducted an analysis of ancestral state reconstruction for characters of taxonomic interest in Galerucinae; this analysis indicated some synapomorphies between Lamprosomatinae and Cryptocephalinae, such as the presence of the kotpresse (shared with the distant Synetinae), and the absence of the tignum in females (found in Synetinae and Chrysomelinae). They noted that female characteristics like the presence or absence of tergite IX as palpi or hemitergites and ventrite IX dorsal to the vagina remain unclear as synapomorphies.

The most recent phylogenetic study, published by Kirsch et al. (2025) using genomic and transcriptomic data, obtained the same relationships as that of Douglas et al. (2023) despite their smaller taxonomic sampling.

Despite these numerous phylogenetic studies on Chrysomelidae (Douglas et al. 2023; Farrel and Sequeira 2004; Gómez-Zurita et al. 2007, 2008; Nie et al. 2020; Zhang et al. 2022; Kirsch et al. 2025), the only study specifically focusing on Lamprosomatinae was conducted by Chamorro and Konstantinov (2011), which was based exclusively on adult morphological characters. Their study included 12 of the 14 recognized genera of the subfamily, representing all four tribes, one of which then described as new. The main results supported the monophyly of Lamprosomatinae and its tribes. Five equally parsimonious trees and the consensus tree recovered the tribe Lamprosomatini, supported by four synapomorphic characters: (1) antennomeres 6 to 8 about as long as wide; (2) scutellum acutely triangular; (3) Elytral punctation arranged in regular rows or with a tendency to form such rows; and (4) stridulatory file on distal border of last abdominal ventrite (in this work we interpret this character as an elytra closing mechanism). Additionally, Lychnophaes was recovered as the sister-group of (Dorisina + Lamprosoma), supported by one synapomorphy, the posterior margin of the last abdominal ventrite convex. In the consensus tree, without unambiguous character support, Dorisina was recovered as the sister-group of Lamprosoma, with their relationship supported by a homoplasious character: sclerotized part of the spermathecal duct short, about as long as the duct of the gland.

Our analyses shed light on new relationships among the tribes of Cryptocephalinae, including Fulcidacini + Pachybrachini and Clytrini + Cryptocephalini, while Mylassini appears in a polytomy with the other groups. For the ML analysis, in addition to the relationship of Clytrini + Cryptocephalini, we verified new arrangements such as Mylassini + Pachybrachini and Fulcidacini as sister lineage of the other tribes (Fig. S1).

Lamprosomatinae was recovered as monophyletic. However, our sample includes only three genera representing the tribe Lamprosomatini (given that when we attempted to extract representatives of Sphaerocharini and other species of Lamprosomatini, the amplification of the target genes was not possible due to the age of the museum-deposited specimens and the limitations of our molecular technique, see Table S2): Lamprosoma, Lychnophaes, and Oomorphoides. Oomorphoides was confirmed as monophyletic, represented by its type species, Oomorphoides cupreatus (Baly), along with others, some of which remain unidentified at the species level. As the sister-group to Oomorphoides, we have an unidentified representative of Lamprosomatinae, possibly another member of Oomorphoides since it appears as a sister group to O. cupreatus in the ML analysis (Fig. S1) or a closely related genus. This clade, in turn, is related to Lamprosoma and Lychnophaes.

It was not possible to confirm the monophyly of Lychnophaes, which is represented only by Ly. imbirucu sp. nov. Conversely, Lamprosoma recovered as clade, with L. cambuci sp. nov. clustering alongside two additional unidentified terminals.

These results corroborate the relationships proposed by Chamorro & Konstantinov (2011) based on morphological data, further reinforcing the synapomorphies proposed for the tribe.

10. Conclusion

Lamprosoma cambuci sp. nov. and Lychnophaes imbirucu sp. nov., both described in this study, were recognized despite the absence of a comprehensive taxonomy revision for both genera. These taxonomic actions were justified by the diagnostic characters provided by Lacordaire (1848), Monrós (1948a, b, 1956), and Caxambú and Almeida (1999, 2003), which confirmed that these specimens did not correspond to any known species.

Several type specimens, deposited by Lacordaire and Germar, are currently unavailable, leading to significant taxonomic impediment and instability for the names. This situation exemplifies the challenges associated with neglected taxa, especially in a visually distinctive and diverse genus like Lamprosoma.

Given the high number of type specimens that are currently unaccounted for in European museums, we emphasize the need to reassess the taxonomy of the genus. In cases where the absence of name-bearing types prevents reliable comparison among species, the designation of neotypes may be necessary to restore nomenclatural stability. For the few species described by Monrós (1948a, b, 1956) and by Caxambú and Almeida (2003), whose type material is preserved in Brazilian and Argentine collections, we recommend a comprehensive taxonomic review. This should include detailed analyses of external and internal morphology, scanning electron microscopy, host-plant information, geographical distribution, and, whenever possible, molecular phylogenetic data. Efforts should also be directed toward integrating molecular data from unsampled lineages, including other tribes, to enhance our understanding of their evolutionary relationships.

11. Declarations

Author contributions. Aluska Tavares dos Santos: Conceptualization, Data Curation, Investigation, Methodology, Visualization, Writing – Original Draft, Writing – Review & Editing. Isaac Reis Jorge: Investigation, Methodology, Visualization, Writing – Review & Editing. Marcos Fianco: Methodology, Analysis, Visualization, Writing – Review & Editing. Aline Sampaio: Investigation, Methodology, Visualization, Writing – Review & Editing. André Luis Martins: Investigation, Methodology, Parasitoid Identification, Visualization, Writing – Review & Editing. José Albertino Rafael: Visualization, Writing – Review & Editing. Andressa Paladini: Supervision, Visualization, Writing – Review & Editing. Paulo Henrique Gorgatti Zarbin: Supervision, Visualization, Writing – Review & Editing.

Funding. This work was supported by the Conselho Nacional de Desenvolvimento Científico e Tecnológico [142496/2019-7, 201147/2024-6, 465511/2014-7, 200079/2025-5, 404656/2024-2, 151844/2022-4], Fundação Araucária [162/2024 PDI], Instituto Nacional de Ciências e Tecnologia de Semioquímicos na Agricultura/Fundação de Amparo à Pesquisa do Estado de São Paulo [50871-0/2014].

Postgraduate programs involved in this study. Programa de Pós-Graduação em Química, Setor de Ciências Exatas, Universidade Federal do Paraná – UFPR, Curitiba, Brazil (ATS, PHGZ). Programa de Pós-Graduação em Entomologia, Setor de Ciências Biológicas, Universidade Federal do Paraná – UFPR, Curitiba, Brazil (ATS, IRJ, MF, AP, PHGZ). Programa de Pós-graduação em Entomologia, Instituto Nacional de Pesquisas da Amazônia – INPA, Av. André Araújo, 2936, Petrópolis, Manaus, Amazonas, Brazil (AS, JAR).

12. Acknowledgements

The authors would like to thank the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and the Instituto Nacional de Ciências e Tecnologia de Semioquímicos na Agricultura (INCT) for their support. AS acknowledges financial support from the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, grant no. 200079/2025-5), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Finance Code 001), and the Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM, Programa Posgrad). We extend our gratitude to Thiago Nicoliello for collecting and sending the material of Lamprosoma, Keli Cristiane C. Morais (Taxonline) for assistance with photography, Jennifer C. Girón Duque for providing Monrós references, and Gary A. P. Gibson for confirming the parasitoid identification. Furthermore, we would like to express our gratitude to Dr. Márcio Oliveira, curator of the Invertebrate Collection of the Instituto Nacional de Pesquisas da Amazônia (INPA) and Dra. Neusa Hamada (Laboratório de Citotaxonomia e Insetos Aquáticos – LACIA, INPA) for providing access to photographic equipment, which enabled us to capture images of the external morphology. We are grateful to Dr. Gabriel A. R. Melo (DZUP, curator of Hymenoptera) for providing the facilities needed to identify the Brasema specimen and for providing access to photographic equipment, and Dr. Mario Cupello for the language review.

13. References

  • Achard J (1914) Coleoptera Phytophaga, Fam. Chrysomelidae, Subfam. Lamprosominae. Genera Insectorum 159: 1–14.
  • Agrain FA, Chamorro ML, Cabrera N, Sassi D, Roig-Juñent S (2017) A comprehensive guide to the Argentinian case-bearer beetle fauna (Coleoptera, Chrysomelidae, Camptosomata). ZooKeys 677: 11–88. https://doi.org/10.3897/zookeys.677.10778
  • Blackwelder RE (1946) Checklist of the coleopterous insects of Mexico, Central America, the West Indies, and South America. Part 4. Bulletin of the United States National Museum 185: 551–763. https://doi.org/10.5479/si.03629236.185.4
  • Bocak L, Barton C, Crampton-Platt A, Chesters D, Ahrens D, Vogler AP (2014) Building the Coleoptera tree-of-life for >8000 species: composition of public DNA data and fit with Linnaean classification. Systematic Entomology 39: 97–110. https://doi.org/10.1111/syen.12037
  • Böving AG, Craighead FC (1931) An illustrated synopsis of the principal larval forms of the order Coleoptera [Larvae of Coleoptera]. Entomologica Americana 11: 351.
  • Casari S, Teixeira E (2008) Immatures of Lamprosoma amethystinum Perty, 1832 (Chrysomelidae, Lamprosomatinae). Zootaxa 1713: 39–46.
  • Caxambú MG (1998) Morfologia e aspectos bioecológicos de Lamprosoma azureum Germar, 1824 (Chrysomelidae, Lamprosomatinae) associado a Psidium cattleianum Sabine, 1821 (Myrtaceae). MSc dissertation, Programa de Pós-Graduação em Ciências Biológicas (Entomologia), Universidade Federal do Paraná, Curitiba, 65 pp.
  • Caxambú MG, de Almeida LM (1999) Descrição dos estágios imaturos e redescrição de Lamprosoma azureum Germar (Chrysomelidae, Lamprosomatinae). Revista Brasileira de Zoologia 16: 2432–2256.
  • Caxambú MG, de Almeida LM (2003) Lamprosoma W. Kirby (Coleoptera, Chrysomelidae): descrição de nova espécie, redescrição e chave para algumas espécies sul americanas. Revista Brasileira de Zoologia 20(2): 329–337.
  • Chaboo CS, Chamorro ML, Matthias S (2016) Catalogue of known immatures stages of Camptosomate leaf beetles (Coleoptera, Chrysomelidae, Cryptocephalinae and Lamprosomatinae). Proceedings of the Entomological Society of Washington 118(2): 150–217. https://doi.org/10.4289/0013-8797.118.1.150
  • Chamorro ML (2014) Lamprosomatinae Lacordaire, 1848. In: Leschen RAB, Beutel RG (Eds) Handbook of Zoology. Arthropoda: Insecta. Coleoptera, Beetles. Volume 3: Morphology and Systematics (Phytophaga). Walter de Gruyter, Berlin/Boston, pp. 226–230. https://doi.org/10.1515/9783110274462.189
  • Chamorro ML, Konstantinov AS (2011) Cachiporrini, a remarkable new tribe of Lamprosomatinae (Coleoptera, Chrysomelidae) from South America. ZooKeys 78: 43–59.
  • Chapuis F (1874) Famille des Phytophages. In: Laccordaire T and Chapuis F (Eds) Histoire naturelle des insectes. Genera des Coléoptères. Libraire Encyclopédique de Roret, Paris (10), 455 pp.
  • Chen SH (1940) On the Coleoptera Chlamydinae of China. Sinensia 11(3–4): 189–206.
  • Chevrolat LAA (1842) In: d’Orbigny C (Ed.) Dictionnaire universel d’histoire naturelle. C. Renard, Paris (2), 795 pp.
  • Crowson RA (1955) The natural classification of the families of Coleoptera. Nathaniel Lloyd, London, 187 pp.
  • DalMolin A (2005) A galha dos frutos de Psidium cattleianum Sabine (Myrtaceae) no primeiro planalto e litoral paranaenses: infestação, suscetibilidade da planta e ontogenia. MSc dissertation, Programa de Pós-Graduação em Ciências Biológicas (Entomologia), Universidade Federal do Paraná, Curitiba, 65 pp.
  • DeAngelis MM, Wang DG, Hawkins TL (1995). Solid-phase reversible immobilization for the isolation of PCR products. Nucleic Acids Research 23: 4742–4743. https://doi.org/10.1093/nar/23.22.4742
  • Douglas HB, Konstantinov AS, Brunke AJ, Moseyko AG, Chapados JT, Eyres J, Richter R, Savard K, Sears E, Prathapan KD, Ruan Y, Dettmn JR (2023) Phylogeny of the flea beetles (Galerucinae: Alticini) and the position of Aulacothorax elucidated through anchored phylogenomics (Coleoptera: Chrysomelidae: Alticini). Systematic Entomology 48(3): 361–386. https://doi.org/10.1111/syen.12582
  • Duckett CN, Gillespie JJ, Kjer KM (2004) Relationships among the subfamilies of Chrysomelidae inferred from small subunit ribosomal DNA and morphology, with special emphasis on the relationship among the flea beetles and the Galerucinae. In: Jolivet P, Santiago-Blay JA, Schmitt M (Eds) New Developments in the Biology of Chrysomelidae. SPB Academic Publishing, The Hague, pp. 3–18. https://doi.org/10.1163/9789004475335_005
  • Erber D (1988) Biology of Camptosomata ClytrinaeCryptocephalinaeChlamisinaeLamprosomatinae. In: Jolivet P, Petitpierre E, Hsiao TH (Eds) Biology of Chrysomelidae. Series Entomologica 42. Kluwer Academic Publishers, Dordrecht, pp. 513–552. https://doi.org/10.1007/978-94-009-3105-3_30
  • Fiebrig K (1910) Cassiden und Cryptocephaliden Paraguays. Ihre Entwicklungsstadien und Schutzvorrichtungen. Zoologische Jahrbücher, Supplement 12: 161–264.
  • Fiori G (1951) Contributi alla conoscenza morfologica ed etologica dei Coleotteri. V. Coptocephala kusteri Kraatz e Cryptocephalus frenatus Laich. (Chrysomelidae). Bollettino dell'Istituto di Entomologia della Università degli Studi di Bologna 18: 182–196.
  • Germar EF (1824) Insectorum species novae aut minus cognitae, descriptionibus illustratae. Volumen primum. Coleoptera. Impensis J. C. Hendelii et Filii, Halae, xxiv + 624 pp. https://doi.org/10.5962/bhl.title.130964
  • Gibson GAP (1995) Parasitic wasps of the subfamily Eupelminae: classification and revision of world genera (Hymenoptera: Chalcidoidea: Eupelmidae). Memoirs on Entomology, International 5: v + 421 pp.
  • Girard M (1873) Les insectes. Traité élémentaire d’entomologie, comprenant l’histoire des espèces utiles et de leurs produits, des espèces nuisibles et des moyens de les détruire, l’étude des métamorphoses et des mœurs, les procédés de chasse et de conservation. Tome 1. Introduction. Coléoptères. J.-B. Baillière et Fils, Paris, 840 pp., 59 pls.
  • Gómez-Zurita J, Hunt T, Kopliku F, Vogler AP (2007) Recalibrated tree of leaf beetles (Chrysomelidae) indicates independent diversification of angiosperms and their insect herbivores. PLoS ONE 2(4): e360. https://doi.org/10.1371/journal.pone.0000360.
  • Gómez-Zurita J, Cardoso A (2021) Molecular systematics, higher-rank classification and Gondwanan origins of Cryptocephalinae leaf beetles. Zoologica Scripta 50(5): 592–615. https://doi.org/10.1111/zsc.12501
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Hawkins TL, O'Connor-Morin T, Roy A, Santillan C (1994) DNA purification and isolation using a solid-phase. Nucleic Acids Research 22(21): 4543–4544. https://doi.org/10.1093/nar/22.21.4543
  • Jacoby M (1880) Biologia Centrali-Americana. Insecta. Coleoptera. Phytophaga (part). Vol. 6, Part 1. R.H. Porter, London, pp. 26–105.
  • Jacoby M (1908) Fauna of British India, including Ceylon and Burma. Coleoptera. Chrysomelidae. Vol. II. Taylor and Francis, London, 534 pp., 2 pls.
  • Jolivet P, Verma KK (2002) Biology of leaf beetles. Intercept Publishers, Andover, 332 pp.
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Kasap H, Crowson RA (1976) On systematic relations of Oomorphus concolor (Sturm) (Col., Chrysomelidae), with descriptions of its larva and of an aberrant cryptocephaline larva from Australia. Journal of Natural History 10(1): 99–112. https://doi.org/10.1080/00222937600770091
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Kirby W, Spence W (1865) An introduction to entomology; or, elements of the natural history of insects: comprising an account of noxious and useful insects, of their metamorphoses, food, stratagems, habitations, societies, motions, noises, hybernation, instinct, etc. Seventh edition. Longmans, Green, and Co., London, 607 pp.
  • Kirsch R, Okamura Y, García-Lozano M, Weiss B, Keller J, Vogel H, Fukumori K, Fukatsu T, Konstantinov AS, Montagna M, Moseyko AG, Riley EG, Ślipiński A, Vencl FV, Windsor DM, Salem H, Kaltenpoth M, Pauchet Y (2025) Symbiosis and horizontal gene transfer promote herbivory in the megadiverse leaf beetles. Current Biology 35(3): 640–654.e7. https://doi.org/10.1016/j.cub.2024.12.028
  • Lacordaire MT (1848) Monographie des coléoptères subpentamères de la famille des Phytophages. Tome II. Mémoires de la Société Royale des Sciences de Liège 5: 1–890.
  • Lawrence JF, Ślipiński A, Seago AE, Thayer MK, Newton AF, Marvaldi AE (2011) Phylogeny of the Coleoptera based on morphological characters of adults and larvae. Annales Zoologici 61(1): 1–217. https://doi.org/10.3161/000345411X576725
  • Linsenmaier W (1972) Insects of the World. McGraw-Hill Book Company, New York, 392 pp.
  • Lis JT, Schleif R (1975) Size fractionation of double-stranded DNA by precipitation with polyethylene glycol. Nucleic Acids Research 2(3): 383–390. https://doi.org/10.1093/nar/2.3.383
  • López S, Rodrigo-Gómez S, Fernández-Carrillo E, Corbella-Martorell C, Quero C (2022) 2-Isobutyl-3-methoxypyrazine as a putative male-specific aggregation pheromone in Labidostomis lusitanica (Germar) (Coleoptera: Chrysomelidae). Preprints 2022120343. https://doi.org/10.20944/preprints202212.0343.v1
  • McKenna DD, Wild AL, Kanda K, Bellamy CL, Beutel RG, Caterino MS, Farnum CW, Hawks DC, Ivie MA, Jameson ML, Leschen RAB, Marvaldi AE, McHugh JV, Newton AF, Robertson JA, Thayer MK, Whiting MF, Lawrence JF, Ślipiński A, Maddison DR, Farrell BD (2015) The beetle tree of life reveals Coleoptera survived end-Permian mass extinction to diversify during the Cretaceous terrestrial revolution. Systematic Entomology 40(4): 835–880. https://doi.org/10.1111/syen.12132
  • Monrós F (1948a) Descripción de diez nuevas espécies de “Lamprosoma” neotropicales (Col., Chrysomelidae). Acta Zoológica Lilloana 5: 81–95.
  • Monrós F (1948b) Descripción de diez nuevos ‘Camptosoma’ neotropicales. Acta Zoológica Lilloana 6: 171–200.
  • Monrós F (1949) Descripción de la metamorfosis de Lamprosoma chorisiae Monrós y consideraciónes taxonómicas sobre Lamprosomatinae (Col., Chrysomelidae). Acta Zoológica Lilloana 7: 449–466.
  • Monrós F (1956) Revision generica de Lamprosomatinae con descripcion de la algunos generos y especies nuevas (Col., Chrysomelidae). Revista Agronomia Noroeste Argentino, San Miguel de Tucumán 2(1): 25–77.
  • Monrós F (1958) Notes on Lamprosomatinae (Chryso). The Coleopterists Bulletin 12: 29–33.
  • Monrós F (1959) Los generos de Chrysomelidae. Opera Lilloana 3: 1–337.
  • Monrós F (1960) Supplementa. Chrysomelidae: Lamprosomatinae. In: Hincks WD (Ed.) Coleopterorum Catalogus. Supplementa, Pars 53(10). W. Junk, 's-Gravenhage, pp. 1–16.
  • Moreira C (1913) Métamorphoses de quelques Coléoptères du Brésil. Annales de la Société entomologique de France 82: 743–751, 4 pls.
  • Morrone JJ, Escalante T, Rodríguez-Tapia G, Carmona A, Arana M, Mercado-Gómez JD (2022) Biogeographic regionalization of the Neotropical region: new map and shapefile. Anais da Academia Brasileira de Ciências 94(1): e20211167. https://doi.org/10.1590/0001-3765202220211167
  • Navarro EA (2013) Dicionário de tupi antigo: a língua indígena clássica do Brasil. Global Editora, São Paulo, 624 pp. ISBN 978-85-260-1933-1.
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Nie R-E, Andújar C, Gómez-Rodríguez C, Bai M, Xue H-J, Tang M, Yang C-T, Tang P, Yang X-K, Vogler AP (2020) The phylogeny of leaf beetles (Chrysomelidae) inferred from mitochondrial genomes. Systematic Entomology 45(1): 188–204. https://doi.org/10.1111/syen.12387
  • Ogloblin DA, Medvedev LN (1971) Larvae of leaf-beetles (Coleoptera, Chrysomelidae) of the European part of the USSR. Nauka, Leningrad, 123 pp. (Keys to the Fauna of the USSR, No. 106)
  • Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Systematic Biology 67: 901–904. https://doi.org/10.1093/sysbio/syy032
  • Reid CAM (1995) A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea). In: Pakaluk J, Ślipiński SA (Eds) Biology, Phylogeny and Classification of Coleoptera: Papers Celebrating the 80th Birthday of Roy A. Crowson. Vol. 2. Muzeum i Instytut Zoologii PAN, Warszawa, pp. 559–631.
  • Santos AT, Souza JPA, Jorge IR, Andrade SMM, Rosa BB, Moura MO, Zarbin PHG (2023) Can pheromones contribute to phylogenetic hypotheses? A case study of Chrysomelidae. Journal of Chemical Ecology 49(8): 611–641. https://doi.org/10.1007/s10886-023-01450-1
  • Seeno TN, Wilcox JA (1982) Leaf beetle genera (Coleoptera: Chrysomelidae). Entomography 1: 1–221.
  • Shorthouse DP (2010) SimpleMappr, an online tool to produce publication-quality point maps. Available at https://www.simplemappr.net (accessed 12 February 2025).
  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87(6): 651–701. https://doi.org/10.1093/aesa/87.6.651
  • Schöller M (2008) Comparative morphology of sclerites used by camptosomatan leaf beetles for formation of the extrachorion (Chrysomelidae: Cryptocephalinae, Lamprosomatinae). In: Jolivet P, Santiago-Blay JA, Schmitt M (Eds) Research on Chrysomelidae. Vol. 1. Brill, Leiden, The Netherlands, pp. 87–120. https://doi.org/10.1163/ej.9789004169470.i-332.39
  • Suzuki K (1988) Comparative morphology of the internal reproductive system of the Chrysomelidae (Coleoptera). In: Jolivet P, Petitpierre E, Hsiao TH (Eds) Biology of Chrysomelidae. Series Entomologica 42. Kluwer Academic Publishers, Dordrecht, pp. 317–355. https://doi.org/10.1007/978-94-009-3105-3_19
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • Weise J (1882) Chrysomelidae. Lieferung 2. In: Naturgeschichte der Insecten Deutschlands. Erste Abteilung. Coleoptera. Sechster Band. Nicolaische Verlags-Buchhandlung, Berlin, pp. 193–368.
  • Wikler C, Pedrosa-Macedo JH, Vitorino MD, Caxambú MG, Smith CW (1999) Strawberry guava (Psidium cattleianum) prospects for biological control. In: Spencer NR (Ed.) Proceedings of the X International Symposium on Biological Control of Weeds. Montana State University, Bozeman, Montana, pp. 659–665.
  • Xiang C-Y, Gao F, Jakovlić I, Lei H-P, Hu Y, Zhang H, Zou H, Wang G-T, Zhang D (2023) Using PhyloSuite for molecular phylogeny and tree-based analyses. iMeta 2(1): e87. https://doi.org/10.1002/imt2.87
  • Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li W-X, Wang G-T (2020) PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096

Supplementary materials

Supplementary material 1 

Figure S1

Santos AT, Jorge IR, Fianco M, Sampaio A, Martins AL, Rafael JA, Paladini A, Zarbin PHG (2026)

Data type: .jpg

Explanation notes: Phylogenetic relationships among species of Lamprosomatinae (Coleoptera, Chrysomelidae) resulting from a Maximum Likelihood analysis of concatenated dataset of 7,004 aligned nucleotides, from the following six gene loci: 12S rDNA; 16S rDNA, 18S rDNA, 28S rDNA and COI. General ML bootstrap values of each node are highlighted. Analysis under models GTR+F+G4 for 12S, GTR+F+I for 18S, GTR+F+I+G4 for 16S, 28S, and COI.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (2.39 MB)
Supplementary material 2 

Tables S1–S4

Santos AT, Jorge IR, Fianco M, Sampaio A, Martins AL, Rafael JA, Paladini A, Zarbin PHG (2026)

Data type: .zip

Explanation notes: Table S1. Data on species of the genera Lamprosoma and Lychnophaes [.xlsx file]. — Table S2. Species used in the molecular analysis, corresponding to the ingroup and outgroup. Specimens and species denoted in red had their DNA extracted, but no amplification was obtained [.xlsx file]. — Table S3. GenBank accession numbers and newly sequenced loci corresponding to 9 species of Lamprosomatinae (ingroup) and 10 species of Cryptocephalinae and Eumolpinae (outgroups) sampled for the following molecular markers: 12S, 16S, 18S, 28S and COI [.xlsx file]. — Table S4. Data on parasitoid associated with Coleoptera families and new records of the Brasema sp. with Lamprosomatinae (Coleoptera, Chrysomelidae) [.xlsx file].

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (48.40 kb)
login to comment