Research Article

Wishbone spiders of the genus Kwonkan Main, 1983 (Araneae: Mygalomorphae: Anamidae) in south-western Australia: Redescription of legacy species, two new species, and an assessment of agricultural zone diversity

‡ School of Biological Sciences, The University of Western Australia, Crawley, Australia

§ Biodiversity and Geosciences Program, Queensland Museum Collections and Research Centre, Hendra, Australia

| Collections & Research, Western Australian Museum, Welshpool, Australia

¶ Alacran Environmental Science, Canning Vale, Australia

# Harry Butler Institute, Murdoch University, Murdoch, Australia

Corresponding author: Jeremy D. Wilson ( jeremy.wilson@museum.wa.gov.au )

Academic editor: Lorenzo Prendini

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation:

ZooBank: urn:lsid:zoobank.org:pub:641D45A2-9141-425B-95CC-00A7C7EFB0E8

Abstract

The collar-door wishbone spiders of the genus Kwonkan Main, 1983 are an Australian-endemic lineage of mygalomorph spiders that often construct elaborate burrow entrances, including collars and turrets, and remain poorly documented across their range, despite museum collections indicating high local endemism and substantial undescribed diversity. Much of the existing taxonomy, including nine of the 14 currently described species, was based on limited material and lacked modern morphological or molecular approaches to species delimitation, hindering efforts to document the remaining diversity and address conservation concerns. Here, we redescribe all nine legacy species and review Kwonkan diversity within the south-western Western Australian (SWWA) agricultural region, a highly fragmented and mostly cleared landscape harbouring extensive undescribed diversity and the threatened species K. eboracum Main, 1983. In the process, we clarify species identities, present the first molecular data for several species including K. eboracum, and describe two new species (K. elatus sp. nov. and K. yorkrakine sp. nov.) that were previously attributed to legacy species. In our review of the SWWA agricultural region fauna we identify 29 putative undescribed species and a pattern of extensive sympatry, fine-scale species turnover, and extremely restricted ranges. These findings highlight the need for continued revisionary work and potential conservation listing of additional described species such as K. wonganensis (Main, 1977).

Keywords

short-range endemism, conservation systematics, mygalomorph spiders, south-western Australian biodiversity hotspot, Wheatbelt

1. Introduction

The ‘collar-door wishbone spiders’ of the genus Kwonkan Main, 1983 are an Australian-endemic group of mygalomorph spiders, currently comprising 14 described species from Western Australia, South Australia, and the Northern Territory (World Spider Catalog, 2026). The genus belongs to the family Anamidae, commonly referred to as ‘open-holed trapdoor spiders’, but represents one of the few lineages within this family that modify their burrow entrances in elaborate ways (Harvey et al. 2018, Wilson et al. 2025a). For example, many species construct burrow entrances with collapsible silken collars, and some build turret entrances out of soil, sand or pebbles (e.g. see Fig. 1). As expected based on these behaviours, species of Kwonkan display several morphological adaptations associated with burrowing and burrow-entrance modification, including a well-developed rastellum, and numerous prodorsal spines on the patella of leg III (Main 1983; Wilson et al. 2023).

Figure 1.

Live spiders and burrows of Kwonkan. A Juvenile K. eboracum from near Kellerberrin, Western Australia (W.A.). B Female K. wonganensis from near Wongan Hills, W.A. C Juvenile K. sp. ‘MYG978’ from the Avon Wheatbelt, W.A. D Burrow entrance morphology (open) of K. eboracum from near Kellerberrin, W.A. E Burrow entrance morphology (closed) of K. wonganensis from near Wongan Hills, W.A. F Burrow entrance morphology (open) of K. sp. ‘MYG978’ from the Avon Wheatbelt, W.A. G, H Burrow entrance morphology of K. turriger, showing both free-standing (G) and foliage-supported (H) burrow entrances. I Burrow entrance morphology (open) of an undescribed Kwonkan species from near Leinster, W.A. — Photos: A, C, F, I by J. Wilson; B, E by E. Volschenk; D by V. Cruz Bedón; G, H by M. Harvey.

Kwonkan is severely understudied, and all work on the genus so far has been piecemeal. Nine species, here called the ‘legacy’ taxa, were originally described by Barbara York Main (Main 1977, 1983, 1986, 1994, 2008) based on limited material and without modern morphological imaging or molecular data. These species were variously placed in Kwonkan, Aname L. Koch, 1873 or Yilgarnia Main, 1986, until multigene phylogenetic analyses resulted in the synonymy of Yilgarnia with Kwonkan and the transfer of Aname turrigera Main, 1994 into Kwonkan (Harvey et al. 2018). Subsequent revisions have added five additional species: three from the central arid zone (Harvey et al. 2023a) and two from the Kimberley (Wilson et al. 2025a). Nevertheless, over 150 undescribed species are represented in the Western Australian Museum (JDW, MSH unpubl. data), indicating that the genus is far more diverse than currently recognised and in need of major taxonomic revision. A critical first step towards this is the redescription of Main’s legacy species using modern methods, which will provide a framework for documenting the remaining undescribed diversity.

Of the nine legacy Kwonkan species, four occur within the south-western Western Australian (SWWA) biodiversity hotspot (Hopper and Gioia 2004; Rix et al. 2015). Although initially defined based on plant diversity, SWWA is now known to harbour invertebrate fauna of comparable richness, endemism, and evolutionary distinctiveness, despite much of this fauna being poorly documented (Moir et al. 2009; Rix et al. 2015; Moir and Young 2023). Geological antiquity, long-term climatic stability, and nutrient-impoverished but heterogeneous soils have repeatedly promoted fine-scale adaptation and local speciation in the flora of the region (Hopper and Gioia 2004), patterns that are probably also reflected in dispersal-limited, substrate-specialised invertebrate fauna such as mygalomorph spiders (Rix et al. 2018a, 2018b, 2023).

Despite its known biodiversity values, SWWA has been extensively modified by agriculture, mining, and urbanisation, and faces a diverse range of external threats including rainfall, increasing temperatures, intensifying fire regimes, pathogens, pests, and salinity (Laurance et al. 2011). The agricultural belt of the transitional rainfall zone, forming a broad band from the Geraldton Sandplains in the north-west, through the Avon Wheatbelt, western Mallee and Esperance Plains in the south-east, represents one of the most heavily cleared and fragmented landscapes in Australia (Keighery 2004; Prober and Smith 2009; Rix et al. 2017). All four SWWA legacy Kwonkan species occur within this region, and the vulnerability of one of them, K. eboracum Main, 1983 has led to its listing as Critically Endangered under the Western Australian ‘Biodiversity Conservation Act 2016’. However, this is likely the tip of the iceberg – the three other species from SWWA are poorly known but display highly restricted ranges, and preliminary examination of the Western Australian Museum collection has revealed unexpectedly high levels of additional undescribed Kwonkan diversity in this region, suggesting that this transitional zone may constitute a centre of diversity for the genus. Such high levels of undocumented diversity in one of Australia’s most modified landscapes represents a critical knowledge gap, hampering conservation efforts and putting vulnerable species at risk of extinction before they have been documented (Rix et al. 2017; Woinarski et al. 2024).

The aims of this study are therefore two-fold: (i) to redescribe all legacy Kwonkan species, providing a foundation for more extensive taxonomy in the genus; and (ii) to conduct a review of Kwonkan diversity in the SWWA agricultural zone to assess species diversity, turnover and distributions, highlighting a diverse and vulnerable fauna for future taxonomic and conservation work. In the process of addressing these aims, we also describe two new species, specimens of which were previously ascribed to legacy species, but which are now recognised as distinct.

2. Material and methods

2.1. Species concept

To relimit named species and describe new species we employed the Retrospective Reproductive Community Concept (RRCC) of Maddison and Whitton (2023). This concept focuses on evidence of past reproductive isolation, rather than current compatibility, and validating both intrinsic (e.g. genetic and/or behavioural) and extrinsic (e.g. geographic) isolating factors (Maddison and Whitton 2023). Our primary evidence of past reproductive isolation came from museum specimens – we identified geographically concordant groups (or in some cases, single individuals) which possess morphological autapomorphies. Males and females were linked through geographical and morphological concordance, making particular use of those morphological characters known to remain consistent between the sexes in anamids (for example some aspects of leg setation, sternum and sternal sigilla shape, as well as size and general colouration). Finally, where sequence data were available for sufficient specimens, we checked that species hypotheses formed a monophyletic group.

2.2. Morphological work

Specimens examined in this study are housed in the Western Australian Museum, Perth (WAM). Specimens were examined and photographed in 75% ethanol with most also represented by leg tissue stored in 100% ethanol at –80°C for DNA preservation. Auto-montaged images were taken with a Leica DFC500 digital camera attached to a Leica MZ16A stereo microscope, using Leica Application Suite X (LAS-X 5.3.0) software (Leica, Wetzlar, Germany). For taxonomic figures of each species, we imaged the holotype specimen along with a specimen of the opposite sex (if available and able to be linked). For male specimens, the left leg I, left pedipalp, right copulatory organ (bulb/embolus), and right leg III were dissected for photography. In images of the copulatory organ, orientation is defined relative to the resting position of the pedipalp. The surface adjacent to the pedipalp is designated as dorsal, and the opposing surface as ventral. These designations are reversed relative to the extended condition; however, the resting-position convention is adopted here for consistency with previous publications on Australian Anamidae (e.g. see Harvey et al. 2023b; Wilson et al. 2025b), and ease of reference. For females, the left leg I, right leg III, and genital plate were dissected. In cases where the appendage on the standard side was damaged or missing, we utilised the corresponding appendage from the opposite side, and in these cases, images are reflected in the taxonomic plates for easy comparison. To image the female genitalia, we first shaved setae from the female genital plate (unless the genital plate was already dissected from the specimen, in which case shaving was not possible), then cleared it in 95% lactic acid until the spermathecae were visible, then imaged the spermathecae from dorsal view.

Standard measurements taken for specimens described in this study, as well as terminology used to refer to taxonomic structures are shown in Figure 5. The following abbreviations are used throughout the text: D = dorsal; Fe = femur; Me = metatarsus; Pa = patella; PL = prolateral; Ta = tarsus; Ti = tibia; V = ventral. All measurements are given in millimetres.

Lists of examined material are ordered alphabetically by site. In the Remarks for each species, we list ‘MYG’ codes, assigned by the Western Australian Museum to putative undescribed species of Mygalomorphae, as per previous publications on Anamidae (e.g. Wilson et al. 2025b).

2.3. Molecular work

To phylogenetically place some previously described species of Kwonkan, we constructed an updated phylogeny for the genus by augmenting the multi-locus molecular dataset presented in Harvey et al. (2018) with new Kwonkan sequence data, including the first sequences of the state-listed threatened species K. eboracum (see Table S1 for molecular specimen information and GenBank codes). In total, 29 specimens were included in the final analysis, including 23 ingroup (Kwonkan) specimens, and 6 outgroup specimens representing other anamid genera (Aname, Hesperonatalius Castalanelli, Huey, Hillyer & Harvey, 2017, Swolnpes Main & Framenau, 2009) and the pycnothelid genus Stanwellia Rainbow & Pulleine, 1918. Sequenced loci included three mitochondrial and four nuclear loci: cytochrome c oxidase subunit I (COI), 12S ribosomal RNA (12S), 16S ribosomal RNA (16S), histone H3 (H3), 18S ribosomal RNA (18S), 28S ribosomal RNA (28S), and elongation factor 1-gamma (EF-1γ). DNA extraction and PCR protocols followed Harvey et al. (2018). Alignment utilised the MAFFT Version 1.3.6 plug-in within Geneious Prime (Katoh and Standley 2013), with the final concatenated alignment being 5,218 bp long. Phylogenetic analysis employed Maximum Likelihood (ML) in the WIQ-TREE online interface (Nguyen et al. 2015; Trifinopoulos et al. 2016). ModelFinder (Kalyaanamoorthy et al. 2017) was used, also through this interface, for selecting an optimal partitioning scheme and optimal models of DNA evolution for each partition. The initial partitioning scheme, provided for assessment and partition merging in ModelFinder, had all loci partitioned separately, and the protein-coding genes (COI, H3, EF-1γ), partitioned by codon. Node support was assessed through 1000 ultrafast bootstrap (UFBS) replicates (Minh et al. 2013). The resulting ML tree was visualised using FigTree Version 1.4.42 (http://tree.bio.ed.ac.uk/software/figtree). Maps were created using QGIS Version 3.44.6 (http://qgis.org), and all figures were generated using GIMP Version 3.0.6-1 (https://www.gimp.org).

For all described species for which COI barcode data are available, we have also included the 658 bp sequence, or consensus sequence when multiple sequences were available, in the species description. For the consensus sequence, we applied a 50% identity rule, calling the most common base when it appeared in more than 50% of specimens for that species and using ambiguity codes in all other cases.

2.4. Redescription of legacy Kwonkan species

The redescription of legacy Kwonkan species focused on three primary objectives: (i) clarifying species identities, (ii) identifying additional specimens of these species, and (iii) providing updated images and morphological descriptions. Re-examination of historical material revealed that, for some legacy species, previously accepted species boundaries or specimen assignments were inaccurate. To address these issues, we also describe two new species, K. elatus sp. nov. and K. yorkrakine sp. nov., each corresponding to specimens that had formerly been included within the limits of legacy species but are now recognised as distinct (see the Remarks section of these species for further information). In addition, we were able to identify and describe, for the first time, the males of K. eboracum and K. wonganensis (Main, 1977).

2.5. Kwonkan diversity in the SWWA agricultural region

To review Kwonkan species diversity across the SWWA agricultural region, male Kwonkan specimens from the Western Australian Museum collection were examined and sorted into putative undescribed species based on morphology (see section 2.1.). Males were used to delimit initial species hypotheses for the usual reasons – to make use of their external secondary sexual structures, which carry a lot of taxonomic information and do not require dissection. For putative species identified in this review, we provide distributional information and maps (Figs 3, 4). For those species represented by four or more populations (collection localities separated by more than ~ 1 km), and where populations were sufficiently dispersed to form a polygon (i.e., not arranged linearly), we estimated extent of occurrence (EOO) by constructing a minimum convex polygon around all collection localities. These estimates are reported on Figs 3 and 4; note that therein the shaded species distributions are not minimum convex polygons, and are included only to assist readers in visualising the distribution of each species.

3. Results and discussion

3.1. Morphological examination

To redescribe the nine legacy Kwonkan species and assess Kwonkan diversity within the SWWA agricultural region, we examined 194 specimens. Of these, 88 specimens were confidently assigned to legacy species. An additional 10 specimens, previously attributed to legacy species, were found to represent two distinct taxa and are here described as new species: K. elatus sp. nov. (8 specimens) and K. yorkrakine sp. nov. (2 specimens) (Figs 2, 3). The remaining 96 specimens were assigned to 29 putative undescribed Kwonkan species from the SWWA agricultural region (Fig. 4).

Figure 2.

Multi-locus Maximum Likelihood phylogeny of Kwonkan. Described taxa are represented in orange, undescribed taxa in black, and outgroup taxa in grey. Support values for major clades show the result of 1000 ultrafast bootstrap replicates. The habitus image is a female of an undescribed Kwonkan from near Leinster, W.A.

Figure 3.

Maps showing the distribution of the nine legacy and two new Kwonkan species described or redescribed in this study. A South-western Australia. B Inset of the central Avon Wheatbelt, where four described species occur. — Stars represent type localities, circles represent other localities; circles with a black outline represent specimens examined in this study, red outline represent iNaturalist records tentatively assigned to a species based on morphology or burrow entrance architecture. Extent of occurrence (EOO) estimates in km² are shown in red beneath species names for taxa with sufficient data. IBRA bioregions are outlined in grey, and abbreviations are as follows: AVW, Avon Wheatbelt; JAR, Jarrah Forest; MAL, Mallee; MUR, Murchison; NUL, Nullarbor; COO, Coolgardie.

Figure 4.

Maps showing the distribution of the 29 putative undescribed species of Kwonkan from the SWWA agricultural zone. The agricultural zone or ‘grain belt’ is shaded in orange, and IBRA bioregions are outlined in grey. All undescribed species have been assigned WA museum ‘MYG codes’. Extent of occurrence (EOO) estimates in km² are shown in red beneath MYG codes for taxa with sufficient data.

Figure 5.

Standard measurements and referenced morphological structures used in this revision. 1 = Prosoma length (summed with abdomen length to get total body length); 2 = Carapace length; 3 = Carapace width; 4 = Fovea width; 5 = Eye group width; 6 = Eye group length; 7 = Abdomen length; 8 = Sternum length; 9 = Sternum width; 10 = Posterior sigilla length; 11 = Femur I length; 12 = Patella I length; 13 = Tibia I length; 14 = Metatarsus I length; 15 = Tarsus I length; 16 = Tibia I width (TID sensu Castalanelli et al. 2020).; 17 = Tibia I megaspine angle; 18 = Tibia I length to distal face of spur (TIS sensu Castalanelli et al. 2020); 19 = Tibial spur height (TISH sensu Castalanelli et al. 2020).; 20 = Tibial megaspine length; 21 = Asetose depression length (PDL sensu Castalanelli et al. 2020); 22 = Metatarsus I width (MID sensu Castalanelli et al. 2020); 23 = Pedipalp tibia length (PTL sensu Castalanelli et al. 2020); 24 = Pedipalp tibia width; 25 = Copulatory organ length; 26 = Bulb length; 27 = Bulb width; 28 = Embolus projection angle; 29 = Embolus width; 30 = Embolus length; 31 = Female genitalia width; 32 = Lateral vesicle length; 33 = Lateral vesicle width at base; 34 = Medial vesicle length; 35 = Medial vesicle width at base.

3.2. Molecular phylogenetics

Kwonkan was recovered as monophyletic with maximal support, as sister to Swolnpes, consistent with the results of Harvey et al. (2018, 2020) (Fig. 2). As in previous analyses, Kwonkan species included in the expanded phylogeny were recovered in three relatively well-supported clades, here defined by the described species they include: the currycomboides-group (UFBS = 98), the turriger-group (UFBS = 83), and the wonganensis-group (UFBS = 100). These clades broadly correspond to taxonomic groupings recognised prior to Harvey et al. (2018), when these lineages were assigned to separate genera. Specifically, the currycomboides-group aligns with the former concept of Yilgarnia, characterised by the presence of spine patches on coxae III–IV. Kwonkan turriger, placed within Aname in earlier classifications, forms part of the turriger-group and is distinguished by the absence of both tarsal spines on the posterior legs and spine patches on coxae III–IV. Finally, the wonganensis-group conforms to Main’s original definition of Kwonkan, characterised by the presence of spines on at least some posterior leg tarsi, and the absence of spine patches on coxae III–IV. Broader taxon sampling is required to assess the monophyly and diagnosability of these groups. At present, six described species are represented in the phylogeny: K. currycomboides (Main, 1986) within the currycomboides-group; K. elatus sp. nov. and K. turriger within the turriger-group; and K. eboracum Main, 1983, K. seductus Harvey, Wilson & Rix, 2023, K. silvestris Main, 1983, and K. wonganensis within the wonganensis-group.

3.3. Kwonkan diversity in the SWWA agricultural region

A total of 34 Kwonkan species are now recognised from the agricultural region of Western Australia. These include four legacy species (K. currycomboides, K. eboracum, K. linnaei (Main, 2008), and K. wonganensis), one newly described species (K. yorkrakine sp. nov.), and 29 putative undescribed species (Figs 3, 4) which were identified on the basis of male morphology (+/- molecular data) in specimens held by the Western Australian Museum. These undescribed species can be broadly divided into two widespread morphological groups that likely correspond to the phylogenetic clades highlighted earlier: the currycomboides-group (characterised by the presence of spine patches on coxae III–IV) and the wonganensis-group (lacking spine patches on coxae III–IV, possessing spines on some posterior leg tarsi). In this context, group assignment is based solely on morphology.

Our results revealed that sympatry is common within Kwonkan, both between these two groups and within them. In some areas, up to five species occur in close proximity. For example, in the Avon Wheatbelt region just north of the town of Kellerberrin, five species co-occur: K. eboracum, K. linnaei, K. yorkrakine sp. nov., K. sp. ‘MYG945’, and K. sp. ‘MYG978’ (Figs 3, 4). Among the described and undescribed species from the agricultural region, 18 are currently known from a single population (Fig. 4). Of the remaining taxa, eight had adequate data for EOO estimation (see Figs 3B, 4), and all have an estimated extent of occurrence of less than 10,000 km² (Fig. 4), qualifying them as short-range endemic (SRE) taxa (Harvey 2002). Collectively, these patterns indicate a serious conservation concern for the Kwonkan fauna of the agricultural region, due to high species richness, fine-scale species turnover, and extremely restricted distributions within a highly fragmented, heterogeneous, and fragile landscape. It is likely that all Kwonkan species in this region meet criteria for short-range endemism and exist in small pockets of their original distribution with a vastly reduced area of occurrence relative to pre-clearing.

Of the described species, K. eboracum (EOO = 2,435 km²) is already listed as Critically Endangered under the Western Australian ‘Biodiversity Conservation Act 2016’. Additional data presented here, including a description of male morphology, live habitus images of the burrow and juvenile, and COI barcode sequence data, will facilitate future monitoring and management of this species. The remaining three species from the central Avon Wheatbelt, K. linnaei (EOO = 7.7 km²), K. wonganensis (EOO = 46.8 km²), and K. yorkrakine sp. nov., were all confirmed to have highly restricted distributions. Kwonkan linnaei is known from just two nature reserves and has an extremely small estimated EOO, reinforcing its conservation significance, though there are no existing threats to these two reserves. We suggest that K. wonganensis is of particular concern: it is a relatively large species that appears to be largely confined to the lateritic hills near the town of Wongan Hills, a region that remains subject to active mining (Fig. 3). This species warrants consideration for formal conservation listing.

4. Taxonomy

Family Anamidae Simon, 1889

Subfamily Anaminae Simon, 1889

4.1. Genus Kwonkan Main, 1983

Kwonkan Main, 1983: 925. Type species: Dekana wonganensis Main, 1977, by original designation.

Yilgarnia Main, 1986: 396. Type species: Yilgarnia currycomboides Main, 1986, by original designation.

Diagnosis.

Modified from Harvey et al. (2018) and Wilson et al. (2025a). — Males of Kwonkan can be distinguished from all other genera of Anamidae by the combined presence of a field of spinules on the retrolateral face of the pedipalpal tibia (e.g. Figs 6K, 9K) (largely absent in other genera, but present in Swolnpes and some Aname) and a digitiform (not incrassate) tarsus I (e.g. Figs 6N, 9N) (incrassate or swollen in Swolnpes). — Both sexes can be further distinguished from other anamid genera by the presence of any (but not necessarily all) of the following characters: coxae III and/or IV with patches of spine-like setae on the posterior half of the ventral face (e.g. Figs 9C, 10C, 16C) (restricted to the currycomboides-group of Kwonkan and absent in other genera); pro-dorsal patella III with a patch of more than three thorn-like spines (e.g. Figs 6I, 7I, 8I) (present in most Kwonkan, absent in other anamid genera); and spines on the tarsi of at least one pair of legs – usually a posterior pair (e.g. Figs 6I, 7I, 8I) (present in most Kwonkan, absent in other anamid genera). — All species described or redescribed here are attributed to Kwonkan using the characteristics above, supported by molecular data for K. currycomboides, K. elatus sp. nov., K. seductus, K. silvestris Main, 1983, K. turriger and K. wonganensis (Fig. 2).

Figure 6.

Kwonkan wonganensis ♂ (WAM T147291). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left pedipalp, full prolateral view (J), partial retrolateral view (K). L M Right copulatory organ, prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Figure 7.

Kwonkan wonganensis ♀ holotype (WAM T10503). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.5 mm.

Figure 8.

Kwonkan anatolion ♀ holotype (WAM T15237). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.5 mm.

Figure 9.

Kwonkan currycomboides ♂ allotype (WAM T17120). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Left leg III (image reflected), prolateral view. J, K Right pedipalp (images reflected), full prolateral view (J), partial retrolateral view (K). L, M Left copulatory organ (images reflected), prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Figure 10.

Kwonkan currycomboides ♀ holotype (WAM T17119). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae, dorsal view, illustration adapted from Main (1986). Scale bars: A, B, J = 2 mm; L = 0.5 mm.

4.2. Kwonkan wonganensis (Main, 1977)

Figures 1B, 1E, 2, 3, 6, 7

Dekana wonganensis Main, 1977: 102, figs 14–16.

Kwonkan wonganensis (Main): Main 1983, 926, figs 2, 3 (transferred from Dekana).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♀; Wongan Hills, Mallee Fowl Gully [Fowler Gully Nature Reserve] (“south end of the Wongan Hills”); 30°51'S 116°38'E; 24 Nov. 1974; B. Y. Main leg.; collected by hand (WAM T10503 [previously WAM 78/596]). — Paratype: AUSTRALIA: Western Australia. • 1 ♀; same data as holotype (WAM T14286 [WAM 82/118]). — Other material examined: AUSTRALIA: Western Australia. • 1 ♂; Rogers Nature Reserve, Waddington-Wongan Hills Road, site WH4; 30°50'11"S 116°39'40"E; 15 Sep. 1998–25 Oct. 1999; B. Durrant, CALM Survey leg.; wet pitfall trap (WAM T147291) • 1 ♂; same data (WAM T147292) • 1 ♂; same data (WAM T147392) • 1 ♀; Wongan Hills; 30°51'S 116°38'E; 24 Oct. 1955; B. Y. Main leg. (WAM T155865) • 1 juvenile; Wongan Hills, 550 m SSE. of Mt O’Brien; 30°50'27"S 116°38'31"E; 335 m; 06 Mar. 2022; M. S. Harvey and M. E. Blosfelds leg.; excavated from burrow (WAM T157120) • 1 juvenile; same data (WAM T157120).

Diagnosis.

Kwonkan wonganensis occurs near K. eboracum, K. linnaei, and K. yorkrakine sp. nov. in the central Avon Wheatbelt bioregion (Fig. 3B). — Both sexes can be distinguished from K. linnaei by the absence of spine patches on coxae III and IV (spine patches present in K. linnaei) (Figs 6C, 7C; cf. Fig. 16C). — Males of K. wonganensis can be distinguished from those of K. eboracum by the presence of a less prominent heel on metatarsus I (heel prominent and angular in K. eboracum) (Fig. 6Q; cf. Fig. 11Q). Males of K. wonganensis can be distinguished from those of K. yorkrakine sp. nov. by the presence of longer, thinner spines on pedipalp tibia (spines shorter and stouter in K. yorkrakine sp. nov.) and a longer embolus (embolus shorter relative to bulb in K. yorkrakine sp. nov.). — Females of K. wonganensis can be distinguished from those of K. eboracum by their spermathecae, which have lateral receptacles with narrower, less triangular bases, and medial receptacles arising near the base of the lateral receptacles (lateral receptacles more triangular, with wider bases, and medial vesicles arising more distally on the lateral receptacles in K. wonganensis) (Fig. 7L; cf. Fig. 12L). Females of K. wonganensis cannot be distinguished from those of K. yorkrakine sp. nov. because females of the latter are unknown. — Burrows of K. wonganensis can be distinguished from all other described Kwonkan species by the presence of a broad and low mound of pebbles around the entrance of the burrow (Fig. 1G).

Figure 11.

Kwonkan eboracum ♂ (WAM T140658). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left pedipalp, full prolateral view (J), partial retrolateral view (K). L, M Right copulatory organ, prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Figure 12.

Kwonkan eboracum ♀ holotype (WAM T15234). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.5 mm.

Description male (WAM T147291).

General: Body length 11.90; in moderate condition, abdomen deformed and faded (Fig. 6A–Q). — Dorsal prosoma: Carapace length 5.45; width 4.58; length/width 1.19; carapace orange-brown, caput darker than thorax; glabrous, light covering of reflective setae; fovea slightly procurved, with a medial cleft; fovea width / carapace length 0.15 (Fig. 6A, F). Chelicerae dark orange-brown; rastellum of short, strong setae, on a slight mound (Fig. 6A, G). Eye group rectangular; width/length 2.05; eye tubercle present (Fig. 6E). — Abdomen: Length 4.81; pale (Fig. 6B, D). — Ventral prosoma: Labium cuspules absent (Fig. 6G, H). Maxillae with distinct heel; with about 45 cuspules extending posteriorly onto heel and laterally about 40% of maxillae length (Fig. 6C, G). Sternum length/width 1.2; central sternum with covering of moderate length, hair-like setae (Fig. 6H). Posterior sigilla elongate; length / sternum length 0.16 (Fig. 6H). Other sigilla small, round and lateral (Fig. 6H). — Leg I: Orange-brown, darker on patella, tibia, and proximal metatarsus; femur length 4.91; patella length 2.72; tibia length 3.81; metatarsus length 4.22; tarsus length 2.76; total length 18.42; leg I length / carapace length 3.38 (Fig. 6N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 6N, O). Spine count Fe D several bristle-like setae; Fe PL 1 (missing); Pa PL 2 (distal missing); Ti PL 1; Ti RL 0; Me PL 0; Me RL 0; Ta 0 (Fig. 6N–Q). Tibia I length/width [TIL/TID] 4.16; even width along length; tibial spur present; spur with single megaspine; spur subdigitiform; megaspine on spur angled at 24° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.65; spur height / tibia width [TISH/TID] 0.54; megaspine length / tibia length 0.25 (Fig. 6N–P). Metatarsus I straight; proximal excavation concave, distal pad with slight, rounded heel; excavation length / metatarsus length [MIPEL/MIL] 0.34; metatarsus length/width [MIL/MID] 6.83 (Fig. 6N, O, Q). — Leg III: Prolateral spine count Fe 3 (proximal 2 missing); Pa 6; Ti 7; Me 15; Ta 3 (Fig. 6I). — Pedipalp: Tibia length 2.25; width 0.82; length/width [PTL/PTD] 2.74; asetose depression absent; retroventral spine-patch present; consisting of about 9 long spines; positioned about 50% of the way along the tibia (Fig. 6J, K). Femur with 1 distal spine (Fig. 6J). Patella prolateral face with 2 dorsal spines (Fig. 6J). Cymbium with scopula present distally (Fig. 6J, K). Copulatory organ length / pedipalp tibia length 0.47 (Fig. 6J–M). Bulb length/width 1.05 (Fig. 6L, M). Embolus tapering gradually from bulb; projecting and curving so as to form an angle of roughly 140° with bulb; embolus width at base / bulb width 0.46; embolus length / bulb length 1.57 (Fig. 6L, M).

Description holotype female (WAM T10503).

General: Body length 18.93; in good condition (Fig. 7A–L). — Dorsal prosoma: Carapace length 7.54; width 6.00; length/width 1.26; carapace orange; glabrous; fovea procurved, with a medial cleft; fovea width / carapace length 0.16 (Fig. 7A, F). Chelicerae red-brown; rastellum of short, strong thorn-like setae on mound (Fig. 7A, G). Eye group rectangular; width/length 2.11; eye tubercle present (Fig. 7E). — Abdomen: Length 7.83; pale laterally and ventrally, with brown chevrons dorsally (Fig. 7B, D). — Ventral prosoma: Labium with two spinules (Fig. 7G, H). Maxillae with distinct heel; with about 100 cuspules extending posteriorly onto heel and laterally about about 60% of maxillae length, blending into spines (Fig. 7C, G). Sternum length/width 1.16; central sternum with covering of mixed short and long hair-like setae (Fig. 7H). Posterior sigilla ovoid; length / sternum length 0.13 (Fig. 7H). Other sigilla small, round and lateral (Fig. 7H). — Leg I: Light orange; femur length 5.21; patella length 3.32; tibia length 3.66; metatarsus length 3.44; tarsus length 2.06; total length 17.68; leg I length / carapace length 2.34 (Fig. 7J, K). Scopulae on metatarsus and tarsus (Fig. 7J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 2; Ti PL 3; Ti RL 4; Me PL 3; Me RL 4; Ta 0 (Fig. 7J, K). Tibia I length/width [TIL/TID] 3.06 (Fig. 7J, K). — Leg III: Prolateral spine count Fe 3; Pa 11; Ti 7; Me 13; Ta 9 (Fig. 7I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 7D, L). Spermathecae with two vesicles each (Fig. 7L). Lateral vesicles relatively straight; angled medially; with distinct, wide and flattened crowns; lateral vesicle length 0.28; lateral vesicle length / genitalia width 0.29; lateral vesicle width at base / genitalia width 0.23; lateral vesicle length / width at base 1.3 (Fig. 7L). Medial vesicles projecting medially from base of lateral vesicle; small and rounded; medial vesicle length / genitalia width 0.11; medial vesicle length / lateral vesicle length 0.37 (Fig. 7L).

Distribution and natural history.

Kwonkan wonganensis is known from several localities, predominantly within nature reserves close to Wongan Hills in the north-western part of the central Avon Wheatbelt bioregion (Fig. 3A, B). Here it is associated with lateritic substrates with small pebbles, which it uses in the construction of its characteristic burrow entrance. The burrow includes a mound around the entrance made from small lateritic rocks and soil (Fig. 1E). The entrance has a soft collar, which the spider can pull closed if disturbed, or to avoid environmental stresses. Main (1977: fig. 13) illustrates a cross section of the burrow with a secondary escape chute opening out the side of the mound in the ‘wishbone’ style typical of many anamids, and this has been confirmed by author ESV.

Remarks.

Kwonkan wonganensis is the type species of the genus Kwonkan, and was hitherto known only from the female. We were able to link males with the female holotype of this species using morphological similarity, geographic proximity, habitat similarity, and phylogenetic concordance. The three known males were collected in September/October, suggesting that males mature and disperse to search for females in spring. The males here associated with K. wonganensis were previously known by the WAM code ‘MYG944’.

COI barcode sequence (WAM T157120).

GACTTTATATTTAATGTTTGGGGTGTGATCTGCTATAATTGGTACGGCTATAAGAGTTATTATTCGGATGGAGTTGGGGCAGGTAGGGAGAATAATGGGTGATGATCATTTGTATAATGTTATGGTCACTGCTCATGCTTTAGTGATGATTTTTTTTATAGTGATGCCTATTATGATTGGGGGGTTTGGAAATTGGTTGGTTCCTTTGATGTTAGGGGTTCCTGATATAGCTTTTCCTCGAATAAATAATTTGAGTTTTTGGTTATTGCCCCCTTCTTTGTTTTTATTGGTTTTGTCGTCCTTGACAGATGTTGGGGTTGGAGCTGGGTGGACTATTTATCCTCCATTGTCTTCTATTGTAGGTCATGGGGGTGGGGGTATAGATTTTGCTATTTTTTCTTTACATTTGGCTGGGGCATCTTCTGTTATAGGGGCGATTAATTTTATTACTACTATTTTAAATATGCGGATTGCTGGGATGACTATGGAGCGTGTTCCGTTGTTTGTTTGGTCTGTTTTAATTACTGCTGTTTTGTTATTGTTGTCTTTACCAGTTTTGGCAGGTGCGGTAACAATGTTATTAACGGATCGGAATTTTAATACATCATTTTTTGATCCTGCGGGAGGTGGTGATCCAATTTTGTTTCAACATTTATTT.

4.3. Kwonkan anatolion Main, 1983

Figures 3A, 8

Kwonkan anatolion Main, 1983: 929, figs 5, 10, 23.

Material examined.

Holotype: AUSTRALIA: South Australia. • ♀; 37 km W. of Penong; 31°56'S 132°37'E; 07 Dec. 1965; B. Y. Main leg.; collected by hand (WAM T15237 [WAM 82/1361]).

Diagnosis.

Kwonkan anatolion occurs near K. elatus sp. nov. and K. turriger on the eastern (South Australian) side of the Nullarbor Plain (Fig. 3A). — Females of K. anatolion can be distinguished from those of K. elatus sp. nov. and K. turriger by the combined presence of spines on at least some of their leg tarsi (tarsal spines absent in K. elatus sp. nov. and K. turriger), and the presence of elongate, curving medial spermathecal receptacles (medial receptacles short and straight in K. elatus sp. nov. and K. turriger) (Fig. 8I–L; cf. Figs 13I–L, 20I–L). — Males of K. anatolion are unknown.

Figure 13.

Kwonkan elatus sp. nov. ♀ holotype (WAM T155754). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.25 mm.

Description holotype female (WAM T15237).

General: Body length 17.95; in moderate condition, abdomen separated from prosoma (Fig. 8A–L). — Dorsal prosoma: Carapace length 6.2; width 5.17; length/width 1.2; carapace red-brown; glabrous; fovea procurved, with a medial cleft; fovea width / carapace length 0.18 (Fig. 8A, F). Chelicerae dark red-brown; rastellum of short, strong thorn-like setae on mound (Fig. 8A, G). Eye group rectangular; width/length 2.16; eye tubercle present (Fig. 8E). — Abdomen: Length 7.69; pale laterally and ventrally, brown chevrons dorsally (Fig. 8B, D). — Ventral prosoma: Labium cuspules absent (Fig. 8G, H). Maxillae with distinct heel; with about 110 cuspules extending posteriorly onto heel and laterally about 70% of maxillae length (Fig. 8C, G). Sternum length/width 1.04; central sternum with covering of moderate length, hair-like setae (Fig. 8H). Posterior sigilla elongate; length / sternum length 0.19 (Fig. 8H). Other sigilla small, round and lateral (Fig. 8H). — Leg I: Light orange; femur length 5.47; patella length 3.56; tibia length 3.71; metatarsus length 3.60; tarsus length 2.12; total length 18.46; leg I length / carapace length 2.98 (Fig. 8J, K). Scopulae on metatarsus and tarsus (Fig. 8J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 2; Ti PL 3; Ti RL 4; Me PL 4; Me RL 4; Ta 2 (Fig. 8J, K). Tibia I length/width [TIL/TID] 2.98 (Fig. 8J, K). — Leg III: Prolateral spine count Fe 3; Pa 9; Ti 6; Me 13; Ta 4 (Fig. 8I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 8D, L). Spermathecae with two vesicles each (Fig. 8L). Lateral vesicles slightly sinuous; angled medially; with distinct rounded crowns; lateral vesicle length 0.44; lateral vesicle length / genitalia width 0.35; lateral vesicle width at base / genitalia width 0.17; lateral vesicle length / width at base 2.11 (Fig. 8L). Medial vesicles projecting medially from base of lateral vesicle; relatively elongate and curving; crown distinct, rounded; medial vesicle length / genitalia width 0.17; medial vesicle length / lateral vesicle length 0.49 (Fig. 8L).

Distribution and natural history.

Kwonkan anatolion is known from one location to the east of the Nullarbor Plain, in the Eyre York Block bioregion of South Australia, near the town of Penong, and less than 1 km from the coast (Fig. 3A). Observation 263553025 (https://inaturalist.ala.org.au/observations/263553025) on iNaturalist, from about 35 km further west, closely resembles this species and is probably conspecific (but this specimen has not been examined by the authors). Nothing is currently known about the natural history of this species.

4.4. Kwonkan currycomboides (Main, 1986)

Figures 2, 3A, 9, 10

Yilgarnia currycomboides Main, 1986: 397, figs 1, 2.

Kwonkan currycomboides (Main): Harvey et al. 2018, 440, fig. 14a–g (transferred from Yilgarnia).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♀; Peak Charles; 32°53'S 121°09'E; 17 May 1956; A. R. Main leg. (WAM T17119 [WAM 85/449]). — Allotype: AUSTRALIA: Western Australia. • 1 ♂; same data as holotype (WAM T17120 [WAM 85/450]). — Other material examined: AUSTRALIA: Western Australia. • 1 ♂; Backmans Road, near Burdett Road junction SE. of Mt Burdett, site ES9; 33°29'05"S 122°14'27"E; 15 Oct. 1999–01 Nov. 2000; P. Van Heurck et al., CALM Survey leg.; wet pitfall trap (WAM T147129) • 2 ♂♂; same data (WAM T147134) • 1 ♂; Grass Patch, ‘Sieda’; 33°14'S 121°46'E; 15 Feb 2005; A. F. Longbottom leg.; in house after stormy night (WAM T88514) • 1 ♂; near Burdett Road-Wittenoom Road junction, SE. of Mt Burdett; 33°27'30"S 122°08'26"E; 15 Sep. 1998–01 Nov. 2000; P. Van Heurck et al., CALM Survey leg.; wet pitfall trap (WAM T172489) • 1 ♂; same data (WAM T172490) • 1 ♂; Norwoods Road, Wittenoom Hills Nature Reserve, site ES7; 33°26'29"S 122°07'17"E; 15 Oct. 1999–01 Nov. 2000; P. Van Heurck et al., CALM Survey leg.; wet pitfall trap (WAM T147503).

Diagnosis.

Kwonkan currycomboides occurs near K. silvestris and K. turriger (Fig. 3A) in the south-eastern agricultural zone of SWWA. — Both sexes can be distinguished from both of these species by the presence of spine patches on ventral coxae III and IV (spine patches absent in K. silvestris and K. turriger) (Figs 9C, 10C; cf. Figs 18C, 19C, 20C).

Description allotype male (WAM T17120).

General: Body length 16.26; in good condition (Fig. 9A–Q). — Dorsal prosoma: Carapace length 5.88; width 5.46; length/width 1.08; carapace orange; glabrous, light covering of reflective setae; fovea straight; fovea width / carapace length 0.15 (Fig. 9A, F). Chelicerae red-brown; rastellum of short, strong setae, on a slight mound (Fig. 9A, G). Eye group rectangular; width/length 2.05; eye tubercle present (Fig. 9E). — Abdomen: Length 7.84; pale laterally and ventrally, dark brown dorsally with mottled bands (Fig. 9B, D). — Ventral prosoma: Labium cuspules absent (Fig. 9G, H). Maxillae with distinct heel; with about 150 cuspules extending posteriorly onto heel and laterally about 60% of maxillae length (Fig. 9C, G). Coxae III and IV with extensive patches of thorn-like setae on ventral faces (Fig. 9C). Sternum length/width 1.2; central sternum with covering of moderate length, hair-like setae (Fig. 9H). Posterior sigilla elongate; length / sternum length 0.19 (Fig. 9H). Other sigilla small, round and lateral (Fig. 9H). — Leg I: Orange, darker on patella, tibia, and proximal metatarsus; femur length 5.92; patella length 3.27; tibia length 4.48; metatarsus length 4.87; tarsus length 2.83; total length 21.36; leg I length / carapace length 3.63 (Fig. 9N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 9N, O). Spine count Fe D 5; Fe PL 2 (both missing); Pa PL 2; Ti PL 1; Ti RL 2 (proximal missing); Me PL 0; Me RL 0; Ta 0 (Fig. 9N–Q). Tibia I length/width [TIL/TID] 4.28; even width along length; tibial spur present; spur with single megaspine (broken); spur subdigitiform; megaspine on spur angled at 25° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.62; spur height / tibia width [TISH/TID] 0.57 (Fig. 9N–P). Metatarsus I slightly sinuous; proximal excavation concave, distal pad with slight, rounded heel; excavation length / metatarsus length [MIPEL/MIL] 0.35; metatarsus length/width [MIL/MID] 6.06 (Fig. 9N, O, Q). — Leg III: Prolateral spine count Fe 3; Pa 3; Ti 9; Me 12; Ta 0 (Fig. 9I). — Pedipalp: Tibia length 2.58; width 0.98; length/width [PTL/PTD] 2.64; asetose depression absent; retroventral spine-patch present; consisting of about 10 long, curving spines; positioned about 55% of the way along the tibia (Fig. 9J, K). Femur with 1 distal spine (missing) (Fig. 9J). Patella prolateral face with row of 2 dorsal and one lateral spine (Fig. 9J). Cymbium with scopula present distally (Fig. 9J, K). Copulatory organ length / pedipalp tibia length 0.42 (Fig. 9J–M). Bulb length/width 1.08 (Fig. 9L, M). Embolus tapering gradually from bulb; projecting and curving so as to form an angle of roughly 136° with bulb; embolus width at base / bulb width 0.38; embolus length / bulb length 1.21 (Fig. 9L, M).

Description holotype female (WAM T17119).

General: Body length 16.73; in moderate condition, abdomen separated from prosoma, genital plate (and spermathecae) missing (Fig. 10A–L). — Dorsal prosoma: Carapace length 6.71; width 5.26; length/width 1.28; carapace orange; glabrous, with a very light covering of reflective setae; fovea procurved; fovea width / carapace length 0.16 (Fig. 10A, F). Chelicerae red-brown; rastellum of short, strong thorn-like setae on mound (Fig. 10A, G). Eye group rectangular; width/length 1.9; eye tubercle present (Fig. 10E). — Abdomen: Length 7.72; light brown laterally and ventrally, grey-brown dorsally with mottled bands (Fig. 10B, D). — Ventral prosoma: Labium cuspules absent (Fig. 10G, H). Maxillae with distinct heel; with about 150 cuspules extending posteriorly onto heel and laterally about 80% of maxillae length (Fig. 10C, G). Coxae III and IV with extensive patches of thorn-like setae on ventral faces (Fig. 10C). Sternum length/width 1.10; central sternum with covering of moderate length, hair-like setae (Fig. 10H). Posterior sigilla elongate; length / sternum length 0.21 (Fig. 10H). Other sigilla small, round and lateral (Fig. 10H). — Leg I: Light orange; femur length 4.73; patella length 3.01; tibia length 3.41; metatarsus length 2.97; tarsus length 1.82; total length 15.94; leg I length / carapace length 2.37 (Fig. 10J, K). Scopulae on metatarsus and tarsus (Fig. 10J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 3; Ti PL 3; Ti RL 4; Me PL 2; Me RL 3; Ta 0 (Fig. 10J, K). Tibia I length/width [TIL/TID] 3.20 (Fig. 10J, K). — Leg III: Prolateral spine count Fe 0; Pa 3; Ti 7; Me 12; Ta 0 (Fig. 10I). — Genitalia (from Main 1986): Spermathecae with two vesicles each (Fig. 10L). Lateral vesicles relatively straight; with indistinct rounded crowns; lateral vesicle length 0.27; lateral vesicle length / genitalia width 0.35; lateral vesicle width at base / genitalia width 0.31; lateral vesicle length / width at base 1.14 (Fig. 10L). Medial vesicles projecting medially from base of lateral vesicle; small and rounded; crown distinct, rounded; medial vesicle length / genitalia width 0.14; medial vesicle length / lateral vesicle length 0.39 (Fig. 10L).

Distribution and natural history.

Kwonkan currycomboides is known from several locations in the Mallee bioregion, north of the town of Esperance, extending from around Mount Burdett in the south to the type locality at Peak Charles in the north. — Nothing is currently known about the natural history of this species.

Remarks.

Males of this species appear to mature and disperse to search for females in the warmer months from September to May. Some specimens here associated with K. currycomboides were previously known by the WAM code ‘MYG458’. The genital plate of this species was not found in the vial with the specimen, and could not be located. Because of this we have adapted Main’s (1986) illustration of the cleared spermathecae in Fig. 10.

COI barcode sequence (WAM T88514).

AACTTTATATTTAATGTTTGGGGTGTGATCTTCTATAGTGGGAACCGCTCTGAGAGTTATTATGCGGGTAGAGCTGGGTCGGGTAGGAAGAATGATGGGTGATGATCACTTGTATAATGTTGTGGTTACAGCACATGCTTTAGTTATGATTTTTTTTATGGTTATGCCTATAATAATTGGGGGGTTTGGGAATTGATTGGTTCCTTTGATATTAGGGGTGCCGGATATGGCTTTTCCTCGAATGAATAATTTGAGTTTTTGGTTATTGCCTCCTTCTTTATTTTTATTACTTGTGTCTTCTCTGACGAATGTGGGTGTTGGGGCTGGGTGGACTATTTATCCCCCCCTGTCTTCGGTTGTTGGTCATAGAGGAGGTGGGGTAGATCTTGTAATTTTTTCTTTGCATTTGGCTGGGGCTTCTTCAATTATGGGGGCTATTAATTTTATTACTACTATTTTAAATATGCGTGTTGAGGGCATGACTATGGAGCGGGTCCCGTTATTTGTTTGGTCTGTTTTAATTACTGCTTTCTTGCTTTTGTTGTCTCTCCCTGTTTTGGCGGGTGCTATTACTATGTTGCTTACTGACCGTAATTTTAATACGTCGTTTTTTGACCCTGCTGGGGGGGGGGATCCTATTTTGTTTCAACATTTGTTT.

4.5. Kwonkan eboracum Main, 1983

Figures 1A, 1D, 2, 3, 11, 12

Kwonkan eboracum Main, 1983: 929, figs 1, 11, 24 (in part, female holotype WAM 82/1358 [WAM T15234]).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♀; Eboracum, 22 km NE. of Tammin; 31°30'03"S 117°32'52"E; 28 Aug. 1956; B. Y. Main leg.; collected by hand (WAM T15234 [BYM 56/470]). — Other material examined: AUSTRALIA: Western Australia. • 1 ♂; “Eboracum” site on York Road, 17 km NNE. of Tammin; 31°30'03"S 117°32'57"E; 29 Nov. 1999–16 Mar. 2000; M. S. Harvey, J. M. Waldock and B. Y. Main leg.; wet pitfall trap (WAM T140657) • 1 ♂; same data (WAM T140658) • 1 ♂; Cookinbin Nature Reserve, site MN8; 31°00'05"S 118°14'00"E; 30 Oct.–15 Dec. 1998; P. Van Heurck, CALM Survey leg.; wet pitfall trap (WAM T147318) • 1 juv.; 10 km NW. of Kellerberrin, intersection of Tremlett & Hanlon Roads; 31°34'43”S 117°37'55”E; 15 Dec. 2025; J. D. Wilson & V. Cruz Bedón, excavated (WAM T173467) • 1 ♂; Leda Nature Reserve on Bruce Rock-Doodlakine Road, site KL5; 31°45'38"S 118°03'47"E; 30 Oct. 1997–22 May 1998; P. Van Heurck and N. A. Guthrie, CALM Survey leg.; wet pitfall trap (WAM T147830).

Diagnosis.

Kwonkan eboracum occurs near K. linnaei, K. yorkrakine sp. nov., and K. wonganensis in the central Avon Wheatbelt bioregion (Fig. 3B). — Both sexes can be distinguished from K. linnaei by the absence of spine patches on coxae III and IV (spine patches present in K. linnaei) (Figs 11C, 12C; cf. Fig. 16C). — Males of K. eboracum can be distinguished from those of K. wonganensis and K. yorkrakine sp. nov. by the presence of a more prominent angular heel on metatarsus I (heel weaker in K. wonganensis and K. yorkrakine sp. nov.) (Fig. 11Q; cf. Figs 6Q, 21Q). — Females of K. eboracum can be distinguished from those of K. wonganensis by their spermathecae, which have lateral receptacles with wider, more triangular bases, and medial receptacles arising about halfway along the length of the lateral receptacles (lateral receptacles less triangular and medial vesicles arising closer to the base of the lateral receptacles in K. wonganensis) (Fig. 12L; cf. Fig. 7L). Females of K. eboracum cannot be distinguished from K. yorkrakine sp. nov. because females of the latter are unknown.

Description male (WAM T140658).

General: Body length 17.74; in moderate condition, ventral prosoma collapsed and deformed (Fig. 11A–Q). — Dorsal prosoma: Carapace length 7.48; width 6.43; length/width 1.16; carapace dark orange-brown; glabrous, light covering of reflective setae; fovea straight; fovea width / carapace length 0.13 (Fig. 11A, F). Chelicerae dark orange-brown; rastellum of short, strong setae, on a slight mound (Fig. 11A, G). Eye group rectangular; width/length 2.01; eye tubercle present (Fig. 11E). — Abdomen: Length 8.15; pale with feint dark chevrons dorsally (Fig. 11B, D). — Ventral prosoma: Labium cuspules absent (Fig. 11G, H). Maxillae with distinct heel; with about 70 cuspules extending posteriorly onto heel and laterally about 40% of maxillae length (Fig. 11C, G). Sternum length/width 1.09; central sternum with covering of moderate length, hair-like setae (Fig. 11H). Posterior sigilla ovoid; length / sternum length 0.11 (Fig. 11H). Other sigilla small, round and lateral (Fig. 11H). — Leg I: Orange, darker on patella, tibia, and proximal metatarsus; femur length 7.18; patella length 3.94; tibia length 5.23; metatarsus length 6.04; tarsus length 3.24; total length 25.62; leg I length / carapace length 3.42 (Fig. 11N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 11N, O). Spine count Fe D several bristle-like setae; Fe PL 3 (proximal missing); Pa PL 2 (distal missing); Ti PL 1; Ti RL 0; Me PL 0; Me RL 0; Ta 0 (Fig. 11N–Q). Tibia I length/width [TIL/TID] 3.61; even width along length; tibial spur present; spur with single megaspine (broken); spur digitiform, with slight medial bend; megaspine on spur angled at 30° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.69; spur height / tibia width [TISH/TID] 0.63 (Fig. 11N–P). Metatarsus I slightly sinuous; proximal excavation concave, distal pad with distinct, broad but sharp heel; excavation length / metatarsus length [MIPEL/MIL] 0.36; metatarsus length/width [MIL/MID] 5.86 (Fig. 11N, O, Q). — Leg III: Prolateral spine count Fe 2; Pa 5; Ti 7; Me 14; Ta 4 (Fig. 11I). — Pedipalp: Tibia length 3.05; width 1.14; length/width [PTL/PTD] 2.66; asetose depression absent; retroventral spine-patch present; consisting of about 15 long spines; positioned about 55% of the way along the tibia (Fig. 11J, K). Femur with 1 distal spine (Fig. 11J). Patella prolateral face with row of 2 distal spines (Fig. 11J). Cymbium with scopula present distally (Fig. 11J, K). Copulatory organ length / pedipalp tibia length 0.44 (Fig. 11J–M). Bulb length/width 0.95 (Fig. 11L, M). Embolus tapering gradually from bulb; projecting and curving so as to form an angle of roughly 150° with bulb; embolus width at base / bulb width 0.48; embolus length / bulb length 1.59 (Fig. 11L, M).

Holotype female (WAM T15234).

General: Body length 18.55; in good condition (Fig. 12A–L). — Dorsal prosoma: Carapace length 7.14; width 5.93; length/width 1.2; carapace light orange; glabrous; fovea procurved; fovea width / carapace length 0.17 (Fig. 12A, F). Chelicerae red-brown; rastellum of short, strong thorn-like setae on mound (Fig. 12A, G). Eye group rectangular; width/length 1.9; eye tubercle present (Fig. 12E). — Abdomen: Length 7.82; pale laterally and ventrally, brown chevrons dorsally (Fig. 12B, D). — Ventral prosoma: Labium with one spinule (Fig. 12G, H). Maxillae with distinct heel; with about 150 cuspules extending posteriorly onto heel and laterally about 70% of maxillae length (Fig. 12C, G). Sternum length/width 1.04; central sternum with covering of mixed short and long hair-like setae (Fig. 12H). Posterior sigilla elongate; length / sternum length 0.18 (Fig. 12H). Other sigilla small, round and lateral (Fig. 12H). — Leg I: Pale; femur length 4.68; patella length 3.08; tibia length 3.25; metatarsus length 3.02; tarsus length 2.02; total length 16.05; leg I length / carapace length 2.25 (Fig. 12J, K). Scopulae on metatarsus and tarsus (Fig. 12J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 3; Ti PL 6; Ti RL 2; Me PL 4; Me RL 5; Ta 2 (Fig. 12J, K). Tibia I length/width [TIL/TID] 2.93 (Fig. 12J, K). — Leg III: Prolateral spine count Fe 2; Pa 7; Ti 6; Me 11; Ta 9 (Fig. 12I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 12L). Spermathecae with two vesicles each (Fig. 12L). Lateral vesicles relatively straight; with distinct, wide and flattened crowns; lateral vesicle length 0.45; lateral vesicle length / genitalia width 0.34; lateral vesicle width at base / genitalia width 0.4; lateral vesicle length / width at base 0.83 (Fig. 12L). Medial vesicles projecting medially from midpoint of lateral vesicle; small and rounded; crown distinct, rounded; medial vesicle length / genitalia width 0.08; medial vesicle length / lateral vesicle length 0.25 (Fig. 12L).

Distribution and natural history.

Identification of the correct male morphology of this species (see below) has led to new information on its distribution. It is now known to occur in the central Avon Wheatbelt bioregion, between Bruce Rock in the south, Tammin in the west, and Cookinbin Nature Reserve in the north-east. Main (1983, p. 930) stated that the holotype female was found “by scraping litter on deep yellow sand in heath-shrubland known locally as wodjil”. A juvenile attributed to K. eboracum (WAM T173467) was collected from a burrow with a collapsible silken collar in whitish-yellow sand (Fig. 1D).

Remarks.

After a thorough examination of wheatbelt Kwonkan specimens housed in the Western Australian Museum, and consideration of morphology and collecting locality, we believe that the male allotype previously associated with K. eboracum (WAM T15235 [WAM 82/1359], now the holotype of K. yorkrakine sp. nov.) was linked with this species in error. We have identified the correct males of this species, which were collected from the type locality. Males of this species appear to mature and disperse to search for females in the warmer months from October to May. The males here associated with K. eboracum were previously known by the WAM code ‘MYG954’. Specimen WAM T148881, from Lake Cronin, was identified as this species by Main (1983), but was examined by us and identified as representing a distinct, undescribed species (not described here).

COI barcode sequence (WAM T173467).

AACTTTGTATTTGATGTTTGGGGTGTGGTCTGCTATGGTGGGTACAGCTATGAGAGTGATTATTCGGATAGAGTTGGGGCAGGTGGGAAGATTGTTGGGTGATGACCATCTATATAATGTTATGGTGACGGCTCATGCTTTAGTTATAATTTTTTTTATAGTGATGCCTATTATGATTGGGGGTTTTGGGAATTGGTTGGTTCCTTTAATGTTAGGAGTTCCTGATATAGCTTTTCCTCGGATGAATAATTTGAGTTTTTGATTGTTGCCGCCTTCTTTGTTTTTGTTAGTTTTGTCATCTTTGACTGATGTGGGGGTGGGGGCTGGGTGAACTGTTTATCCTCCTTTGTCTTCTGTTGTAGGTCATAGAGGTGGGGGGATGGATTTTGCAATTTTTTCTTTGCATTTGGCTGGGGCTTCTTCTGTTATAGGGGCTATTAATTTTATTACTACTATTTTAAATATGCGGGTTACTGGGATGACTTTGGAACGTATCCCTTTGTTTGTTTGGTCTGTCTTAATTACTGCTGTATTGTTGTTGTTGTCTTTGCCAGTTTTGGCTGGTGCTGTAACTATGTTATTAACAGATCGAAATTTTAATACATCGTTTTTTGACCCTGCGGGAGGGGGTGATCCAATTTTGTTTCAACATTTATTT.

4.6. Kwonkan elatus sp. nov.

https://zoobank.org/CBB7966B-403C-48DD-9BC8-1C16780E3AA5

Figures 2, 3A, 13

Aname turrigera Main, 1994: 65, fig. 1a–k (in part: specimens listed in material examined below).

Material examined.

Holotype: AUSTRALIA: South Australia. • ♀; 18 km W. of Lock; 33°34'S 135°34'E; 08 May 1986; B. Y. Main leg.; excavated from burrow [K. turriger paratype, apparently collected with brood, but these are not present in vial] (WAM T155754 [BYM 86/29]). — Paratype: AUSTRALIA: South Australia. • 1 ♀; 18 km W. of Lock; 33°34'S 135°34'E; 18 May 1986; B. Y. Main leg.; excavated from burrow [K. turriger paratype] (WAM T155758 [BYM 86/102]). — Other material examined: AUSTRALIA: South Australia. • 1 juvenile; 12 km NW. of Ceduna, Eyre Highway; 32°03'00"S 133°35'54"E; 20 m; 31 Aug. 2014; M. S. Harvey and S. E. Harrison leg.; dug from aerial tube in Triodia (WAM T134209) • 1 juvenile; 18 km W. of Lock; 33°34'S 135°34'E; 18 May 1986; B. Y. Main leg.; excavated from burrow [K. turriger paratype] (WAM T155755 [BYM 86/98]) • 1 juvenile; 18 km W. of Lock; 33°34'S 135°34'E; 18 May 1986; B. Y. Main leg.; excavated from burrow [K. turriger paratype] (WAM T155756 [BYM 86/99]) • 1 juvenile; 18 km W. of Lock; 33°34'S 135°34'E; 18 May 1986; B. Y. Main leg.; excavated from burrow [K. turriger paratype] (WAM T155757 [BYM 86/101]) • 1 juvenile; 20 km S. of Lock; 33°44'S 135°42'E; 26 Nov. 1987; B. Y. Main leg.; dug from aerial tube in Triodia (WAM T155764) • 1 ♀; 29.6 km N. of Minnipa; 32°35'S 135°09'E; 16 May 1981; B. Y. Main leg.; excavated from burrow [K. turriger paratype] (WAM T155759 [BYM 81/4]).

Diagnosis.

Kwonkan elatus sp. nov. occurs near K. anatolion and K. turriger on the eastern (South Australian) side of the Nullarbor Plain (Fig. 3A). — Females of K. elatus sp. nov. can be diagnosed from those of K. anatolion by the absence of spines on their leg tarsi (tarsal spines present on at least some legs of K. anatolion) and the presence of short, straight medial spermathecal receptacles (medial receptacles longer and curving in K. anatolion) (Fig. 13I, L; cf. Fig. 8I, L). They can be distinguished from K. turriger by the presence of longer lateral spermathecal receptacles (Fig. 13L; cf. Fig. 20L). — Males of all three species are unknown.

Etymology.

The specific epithet ‘elatus’ is a Latin adjective meaning ‘elevated, lofty, exalted’. It alludes to the burrow entrances of this species, which project from the substrate, often extending into low foliage and grasses, especially spinifex (similar to Fig. 1D, E). The same burrow type is constructed by its sister species K. turriger.

Description holotype female (WAM T155754).

General: Body length 12.43; in good condition, abdomen slightly deformed (Fig. 13A–L). — Dorsal prosoma: Carapace length 4.17; width 3.22; length/width 1.3; carapace light orange; glabrous; fovea procurved, with a feint medial cleft; fovea width / carapace length 0.14 (Fig. 13A, F). Chelicerae orange; rastellum of short, strong thorn-like setae on mound (Fig. 13A, G). Eye group rectangular; width/length 2.19; eye tubercle present (Fig. 13E). — Abdomen: Length 5.63; white laterally and ventrally, with dark brown, thin chevrons dorsally (Fig. 13B, D). — Ventral prosoma: Labium cuspules absent (Fig. 13G, H). Maxillae with distinct heel; with about 40 cuspules extending posteriorly onto heel and laterally about 20% of maxillae length (Fig. 13C, G). Sternum length/width 1.07; central sternum with covering of moderate length, hair-like setae (Fig. 13H). Posterior sigilla ovoid; length / sternum length 0.08 (Fig. 13H). Other sigilla small, round and lateral (Fig. 13H). — Leg I: Pale orange; femur length 2.97; patella length 1.8; tibia length 1.92; metatarsus length 1.61; tarsus length 1.18; total length 9.48; leg I length / carapace length 2.28 (Fig. 13J, K). Scopulae on metatarsus and tarsus (Fig. 13J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 2; Ti PL 2; Ti RL 4; Me PL 3; Me RL 3; Ta 0 (Fig. 13J, K). Tibia I length/width [TIL/TID] 2.94 (Fig. 13J, K). — Leg III: Prolateral spine count Fe 0; Pa 2; Ti 3; Me 5; Ta 0 (Fig. 13I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 13D, L). Spermathecae with two vesicles each (Fig. 13L). Lateral vesicles relatively straight; angled medially; with distinct, rounded crowns; lateral vesicle length 0.21; lateral vesicle length / genitalia width 0.29; lateral vesicle width at base / genitalia width 0.14; lateral vesicle length / width at base 2.04 (Fig. 13L). Medial vesicles projecting medially from base of lateral vesicle; small and rounded; crown distinct, rounded; medial vesicle length / genitalia width 0.09; medial vesicle length / lateral vesicle length 0.32 (Fig. 13L).

Distribution and natural history.

Kwonkan elatus sp. nov. occurs on the Eyre Peninsula, in the Eyre York Block bioregion (Fig. 3A). The type locality and main population occur south-west of Lock, in the central northern Eyre Peninsula, and other specimens tentatively ascribed to the species occur as far west as Ceduna. The burrows of K. elatus sp. nov. and its sister species K. turriger extend above the substrate as a soil and silken turret, which may be free-standing, or project into low foliage (typically spinifex or chenopod shrubs) (similar to Fig. 1G, H). More detailed information on the burrow structure and life history of K. turriger sensu lato (as then circumscribed, and now comprising both K. elatus sp. nov. and K. turriger), is provided in Main (1994).

Remarks.

Kwonkan elatus sp. nov. was previously known by the WAM code ‘MYG1030’. Specimens of K. elatus sp. nov. were previously assigned to K. turriger, but are here recognised as a distinct species based on both morphological and molecular data. Other specimens that probably represent this species, but have not been examined, include South Australian Museum (SAM) female specimen N1994396 [BYM 86/60] from 18 km W. of Lock. Female specimen WAM T155761 [BYM 86/67] from Ardrossan was tentatively assigned to this species by Main (1994). We examined it as part of this study and it appears to represent another distinct species in the turriger-group, but further investigation (and potentially molecular work) is required to confirm this.

COI barcode sequence (WAM T134209).

NNNNNNNNNNNNNNNNNNNNGAGTGTGATCTGCTATGGTTGGAACTGCTATGAGAGTTGTTGTACGTACGGAATTGGGTCAGGTTGGGAGATTGTTAGGTGATGATCATTTGTATAATGTGATAGTGACGGCGCATGCTTTAGTGATGATTTTTTTTATAGTAATACCTATTATGATTGGGGGGTTTGGTAATTGGTTAGTTCCTTTAATGTTAGGAGCTCCTGATATAGCATTTCCTCGTATAAATAATTTAAGATTTTGGTTGTTGCCTCCTTCCTTGTTTATGTTAGTGTTATCATCTTTGGCAGATGTTGGGGTGGGGGCTGGGTGAACAATTTATCCTCCTTTGTCCTCAGGTGTTGGACATGGGGGAATAGGGATAGATTTTGTTGTTTTTTCTTTGCATTTAGCTGGGGTTTCTTCTATTATAGGGGCTATTAATTTTATTACTACTATTGTTAATATGCGTATGGTAGGGATGACTATAGAGCGGGTTCCTCTTTTTGTATGATCTGTTTTAATTACTGCTGTGTTGCTTTTATTATCTTTACCGGTTTTGGCGGGTGCTATTACAATATTATTGACTGATCGGAATTTTAATACTTCATTTTTTGATCCTGCTGGGGGGGGAGACCCTATTTTATTTCAACATTTATTT.

4.7. Kwonkan goongarriensis Main, 1983

Figures 3A, 14, 15

Kwonkan goongarriensis Main, 1983: 926, figs 6–8, 12, 14–22, 25, 28–30, 34, 38, 42.

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♂; Goongarrie; 29°59'S 121°02'E; 15 Jul. 1981–21 Jul. 1981; W.F. Humphries, B. Y. Main, et al. leg.; pitfall trap; Casuarina woodland (WAM T15228 [WAM 82/1352]). — Allotype: AUSTRALIA: Western Australia. • 1 ♀; 37 km NE. of Menzies, between Menzies and Kookynie; 29°28'S 121°18'E; 20 May 1956; A. R. Main leg.; collected by hand (WAM T15229 [WAM 82/1353]). — Paratypes: AUSTRALIA: Western Australia. • 1 ♀; 17.7 km N. of Kookynie; 29°11'S 121°28'E; 01 Sep. 1954; B. Y. Main leg.; collected by hand (WAM T15230 [WAM 82/1354]) • 1 juvenile; Goongarrie; 29°59'S 121°02'E; 15 Jul. 1981–21 Jul. 1981; B. Y. Main leg.; collected by hand (WAM T15231 [WAM 82/1355]).

Diagnosis.

Kwonkan goongarriensis does not occur near any other described species in the southern Murchison bioregion, however the closest species geographically are K. moriartii Main, 1983 to the north, K. silvestris to the south, and K. turriger to the south-east (Fig. 3A). — Males of K. goongarriensis can be distinguished from those of K. moriartii and K. silvestris by the presence of a relatively short, gradually curving embolus (embolus longer relative to the bulb in K. silvestris, and straighter with a distal bend in K. moriartii) (Fig. 14L; cf. Figs 17L, 18L). Males of K. goongarriensis cannot be distinguished from those of K. turriger because males of the latter are unknown. — Females of K. goongarriensis can be distinguished from those of K. silvestris by the presence of lateral spermathecal vesicles with rounded crowns (crowns flattened in K. silvestris) (Fig. 15L; cf. Fig. 19L). They can be distinguished from those of K. turriger by the presence of spines on at least some of their tarsi (tarsal spines absent in K. turriger) (Fig. 15L; cf. Fig. 20L).

Figure 14.

Kwonkan goongarriensis ♂ holotype (WAM T15228). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Right pedipalp (images reflected), full prolateral view (J), partial retrolateral view (K). L, M Left copulatory organ (images reflected), prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Figure 15.

Kwonkan goongarriensis ♀ allotype (WAM T15229). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.5 mm.

Description holotype male (WAM T15228).

General: Body length 10.07; in good condition (Fig. 14A–Q). — Dorsal prosoma: Carapace length 4.51; width 3.35; length/width 1.35; carapace yellow, caput darker than thorax; glabrous; fovea straight, with a medial cleft; fovea width / carapace length 0.13 (Fig. 14A, F). Chelicerae yellow-brown; rastellum of short, strong setae, not on a mound (Fig. 14A, G). Eye group rectangular; width/length 2.25; eye tubercle present (Fig. 14E). — Abdomen: Length 4.76; pale laterally and ventrally, dark grey-brown chevrons dorsally (Fig. 14B, D). — Ventral prosoma: Labium cuspules absent (Fig. 14G, H). Maxillae with distinct heel; with about 40 cuspules extending posteriorly onto heel and laterally about 40% of maxillae length (Fig. 14C, G). Sternum length/width 1.18; central sternum with covering of short length hair-like setae (Fig. 14H). Posterior sigilla rounded; length / sternum length 0.08 (Fig. 14H). Other sigilla small, round and lateral (Fig. 14H). — Leg I: Yellow, darker on patella, tibia, and proximal metatarsus; femur length 4.09; patella length 2.37; tibia length 3.07; metatarsus length 3.53; tarsus length 2.27; total length 15.33; leg I length / carapace length 3.4 (Fig. 14N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 14N, O). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 1; Ti PL 1; Ti RL 3; Me PL 0; Me RL 0; Ta 0 (Fig. 14N–Q). Tibia I length/width [TIL/TID] 3.78; even width along length; tibial spur present; spur with single megaspine; spur subdigitiform; megaspine on spur angled at 30° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.7; spur height / tibia width [TISH/TID] 0.41; megaspine length / tibia length 0.27 (Fig. 14N–P). Metatarsus I straight; proximal excavation inconspicuous; excavation length / metatarsus length [MIPEL/MIL] 0.36; metatarsus length/width [MIL/MID] 7.3 (Fig. 14N, O, Q). — Leg III: Prolateral spine count Fe 3; Pa 9; Ti 9; Me 11; Ta 2 (Fig. 14I). — Pedipalp: Tibia length 1.82; width 0.85; length/width [PTL/PTD] 2.14; asetose depression absent; retroventral spine-patch present; consisting of about 5 short sines; positioned about 40% of the way along the tibia (Fig. 14J, K). Femur with 0 (Fig. 14J). Patella prolateral face with row of 1 (Fig. 14J). Cymbium with scopula present distally (Fig. 14J, K). Copulatory organ length / pedipalp tibia length 0.53 (Fig. 14J–M). Bulb length/width 1.14 (Fig. 14L, M). Embolus demarcated from bulb; projecting and curving so as to form an angle of roughly 114° with bulb; embolus width at base / bulb width 0.44; embolus length / bulb length 1.18 (Fig. 14L, M).

Description allotype female (WAM T15229).

General: Body length 18.00; in good condition, most setae rubbed off sternum (Fig. 15A–L). — Dorsal prosoma: Carapace length 6.12; width 5.47; length/width 1.12; carapace light orange; glabrous; fovea procurved; fovea width / carapace length 0.18 (Fig. 15A, F). Chelicerae red-brown; rastellum of short, strong thorn-like setae on mound (Fig. 15A, G). Eye group rectangular; width/length 2.24; eye tubercle present (Fig. 15E). — Abdomen: Length 8.54; pale laterally and ventrally, brown chevrons dorsally (Fig. 15B, D). — Ventral prosoma: Labium cuspules several spinules (Fig. 15G, H). Maxillae with distinct heel; with about 130 cuspules extending posteriorly onto heel and extending laterally about 60% of maxillae length, blending into spines laterally (Fig. 15C, G). Sternum length/width 1.16; central sternum with setae rubbed off (Fig. 15H). Posterior sigilla ovoid; length / sternum length 0.14 (Fig. 15H). Other sigilla small, round and lateral (Fig. 15H). — Leg I: Pale; femur length 5.16; patella length 3.28; tibia length 3.28; metatarsus length 3.37; tarsus length 1.89; total length 16.98; leg I length / carapace length 2.77 (Fig. 15J, K). Scopulae on metatarsus and tarsus (Fig. 15J, K). Spine count Fe D several bristle-like setae (all rubbed off except proximal); Fe PL 2 (distal rubbed off); Pa PL 2; Ti PL 2; Ti RL 4; Me PL 4; Me RL 5; Ta 4 (Fig. 15J, K). Tibia I length/width [TIL/TID] 2.8 (Fig. 15J, K). — Leg III: Prolateral spine count Fe 3; Pa 8; Ti 8; Me 11; Ta 8 (Fig. 15I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 15D, L). Spermathecae with two vesicles each (Fig. 15L). Lateral vesicles relatively straight; angled medially; with distinct rounded crowns; lateral vesicle length 0.65; lateral vesicle length / genitalia width 0.29; lateral vesicle width at base / genitalia width 0.15; lateral vesicle length / width at base 1.91 (Fig. 15L). Medial vesicles projecting medially from base of lateral vesicle; small and rounded; crown distinct, rounded; medial vesicle length / genitalia width 0.14; medial vesicle length / lateral vesicle length 0.46 (Fig. 15L).

Distribution and natural history.

Kwonkan goongarriensis is known from three locations, in the southern part of the Murchison bioregion. The type locality represents the southernmost locality, with the most northerly location about 17 km north of Kookynie. Main (1983, 929) states that the species makes ‘shallow, silk-lined tubes’ in heath, Casuarina woodland and shrubland.

Remarks.

The holotype is the only known male of this species, and was collected in July, suggesting males may mature and disperse to search for females in winter. Juvenile specimen WAM 169294 [BYM 54/382] was tentatively identified as this species by Main (1983) but after examination, we have identified it as representing a distinct undescribed species (not described here).

4.8. Kwonkan linnaei (Main, 2008)

Figures 3, 16

Yilgarnia linnaei Main, 2008: 322, figs 1–9.

Kwonkan linnaei (Main): Harvey et al., 2018, 442 (tranferred from Yilgarnia).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♂; Durokoppin Nature Reserve, Northwest Tip; 31°25'S 117°44'E; 06–27 May 1987; B. Y. Main leg.; wet pitfall trap (WAM T89289 [BYM 87/83]). — Paratypes: AUSTRALIA: Western Australia. •5 ♂♂; same data as holotype (WAM T155873 [BYM 87/73-77]) • 1 ♂; same data (WAM T155874 [BYM 88/6]) • 5 ♂♂; same data except 20 Mar.–03 May 1988 (WAM T155876 [BYM 88/13-17]) • 2 ♂♂; same data except 03 May–25 Jun. 1988 (WAM T155877 [BYM 88/25-26])• 1 ♂; same data except 13 Mar.–03 May 1989 (WAM T92128 [BYM 89/10]) • 1 ♂; same data (WAM T92129 [BYM 89/11]) • 1 ♂; same data (WAM T147365 [BYM 89/12]) • 8 ♂; same data (WAM T155879 [BYM 89/13-20]) • 4 ♂♂; same data except 17 Mar.–03 May 1989 (WAM T155878 [BYM 89/4-7]) • 3 ♂♂; same data except 03 May–03 Jun. 1989 (WAM T155880 [BYM 89/26-28]) • 8 ♂♂; same data (WAM T155881 [BYM 89/32-35]) • 2 ♂♂; same data (WAM T155882 [BYM 89/45-46]) • 2 ♂♂; same data except 20 Feb–29 Apr. 1991 (WAM T155883 [BYM 91/1-2]) • 1 ♂; same data (WAM T92130 [BYM 91/19]) • 1 ♂; same data (WAM T92131 [BYM 91/20]) • 1 ♂; same data (WAM T92132 [BYM 91/21]) • 1 ♂; same data (WAM T92133 [BYM 91/27]) • 1 ♂; same data (WAM T92134 [BYM 91/28]) • 1 ♂; same data (WAM T92135 [BYM 91/29]) • 5 ♂♂; same data except 29 Apr.–02 Jul. 1991 (WAM T155884 [BYM 91/22-26]) • 5 ♂♂; same data (WAM T155885 [BYM 91/30-34]) • 2 ♂♂; same data (WAM T155886 [BYM 91/37-38]) • 1 ♂, 1 juvenile; same data (WAM T155887 [BYM 91/40-41]). — Paratypes not examined (never formally accessioned at WAM): AUSTRALIA: Western Australia. • 2 ♂; same data as holotype (BYM 87/79) • 1 ♂; same data except 27 May–23 June 1987 (BYM 87/86) • 1 ♂; same data (BYM87/88) • 1 ♂; same data (BYM87/89) • 1 ♂; same data except 23 June–04 August 1987 (BYM 87/99) • 1 ♂; same data except 20 March–03 May 1988 (BYM 88/5) • 1 ♂; same data except 03 May–25 June 1988 (BYM 88/24) • 1 ♂; same data except 17 March–02 May 1989 (BYM 89/3) • 1 ♂; same data (BYM 89/9) • 1 ♂; same data except 17 March–03 May 1989 (BYM 89/36) • 1 ♂; same data except 03 May–03 June 1989 (BYM 89/47) • 1 ♂; same data (BYM 89/48) • 1 ♂; same data except 03 June–08 July 1989 (BYM 89/57) • 1 ♂; same data except 07 February–29 April 1990 (BYM 90/53) • 1 ♂; same data (BYM 90/54) • 1 ♂; same data except 04 June–19 July 1990 (BYM 90/56) • 1 ♂; same data (BYM 90/57) • 1 ♂; same data (BYM 90/67) • 1 ♂; same data except 29 April–02 July 1991 (BYM 91/44) • 1 ♂; same data except 02 July–30 July 1991 (BYM 91/45). — Other material examined: AUSTRALIA: Western Australia. • 2 ♂♂; same data as holotype except 20 Mar.–03 May 1988 (WAM T155875 [BYM 88/4]) • 2 ♂♂; same data except 13 Mar. 1992–23 Mar. 1992; G. Friend et al. leg. (WAM T41521) • 1 ♂; same data (WAM T41596) • 3 ♂♂; same data (WAM T41523) • 1 ♂; Bencubbin-Kellerberrin Road, site KL9; 31°24'37"S 117°45'06"E; 22 May–22 Sep. 1998; N. A. Guthrie, CALM Survey leg.; wet pitfall trap (WAM T147246) • 1 ♂; East Yorkrakine Nature Reserve, site EYR J2; 31°23'S 117°40'E; 19 May 1989–29 May 1989; G. Friend et al. leg.; pitfall trap (WAM T41381) • 1 ♂; same data (WAM T40709) • 3 ♂♂; same data (WAM T41567) • 2 ♂♂; same data (WAM T41597) • 2 ♂♂; same data (WAM T41382) • 1 ♂; same data (WAM T41598) • 2 ♂♂; same data (WAM T44289) • 1 ♂; same data (WAM T41599) • 2 ♂♂; same data (WAM T41600).

Diagnosis.

Kwonkan linnaei occurs near K. eboracum, K. yorkrakine sp. nov., and K. wonganensis in the central Avon Wheatbelt bioregion (Fig. 3B). — Both sexes can be distinguished from those species by the presence of spine patches on ventral coxae III and IV (spine patches absent in K. eboracum, K. wonganensis and K. yorkrakine sp. nov.).

Description holotype male (WAM T89289).

General: Body length 7.41; in moderate condition, abdomen slightly damaged (Fig. 16A–Q). — Dorsal prosoma: Carapace length 2.63; width 1.82; length/width 1.44; carapace yellow, caput darker than thorax; glabrous; fovea procurved, with a medial cleft; fovea width / carapace length 0.09 (Fig. 16A, F). Chelicerae yellow-brown; rastellum of short, strong setae, not on a mound (Fig. 16A, G). Eye group rectangular; width/length 2.2; eye tubercle present (Fig. 16E). — Abdomen: Length 3.72; pale laterally and ventrally, dark grey-brown mottled chevrons dorsally (Fig. 16B, D). — Ventral prosoma: Labium cuspules absent (Fig. 16G, H). Maxillae with distinct heel; with about 40 cuspules extending posteriorly onto heel and laterally about 35% of maxillae length (Fig. 16C, G). Coxae cuspules with extensive patches of thorn-like setae on coxae III and IV (Fig. 16C). Sternum length/width 1.29; central sternum with covering of short length hair-like setae (Fig. 16H). Posterior sigilla rounded, inconspicuous; length / sternum length 0.11 (Fig. 16H). Other sigilla small, round and lateral (Fig. 16H). — Leg I: Pale yellow, darker on patella, tibia, and proximal metatarsus; femur length 2.25; patella length 1.24; tibia length 1.86; metatarsus length 1.66; tarsus length 0.97; total length 7.98; leg I length / carapace length 3.03 (Fig. 16N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 16N, O). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 1; Ti PL 1; Ti RL 2; Me PL 0; Me RL 0; Ta 0 (Fig. 16N–Q). Tibia I length/width [TIL/TID] 4.34; even width along length; tibial spur present; spur with single megaspine; spur small, triangular; megaspine on spur angled at 19° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.62; spur height / tibia width [TISH/TID] 0.22; megaspine length / tibia length 0.28 (Fig. 16N–P). Metatarsus I slightly sinuous; proximal excavation inconspicuous, metatarsus broad and bowed; excavation length / metatarsus length [MIPEL/MIL] 0.41; metatarsus length/width [MIL/MID] 4.38 (Fig. 16N, O, Q). — Leg III: Prolateral spine count Fe 1; Pa 3; Ti 6; Me 10; Ta 0 (Fig. 16I). — Pedipalp: Tibia length 1.01; width 0.53; length/width [PTL/PTD] 1.9; asetose depression absent; retroventral spine-patch present; consisting of about 7 short spines; positioned about 40% of the way along the tibia (Fig. 16J, K). Femur with 0 (Fig. 16J). Patella prolateral face with row of 1 (Fig. 16J). Cymbium with scopula present distally (Fig. 16J, K). Copulatory organ length / pedipalp tibia length 0.56 (Fig. 16J–M). Bulb length/width 1.21 (Fig. 16L, M). Embolus tapering gradually from bulb; projecting and curving so as to form an angle of roughly 140° with bulb; embolus width at base / bulb width 0.49; embolus length / bulb length 0.94 (Fig. 16L, M).

Figure 16.

Kwonkan linnaei ♂ holotype (WAM T89289). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left pedipalp, full prolateral view (J), partial retrolateral view (K). L, M Right copulatory organ, prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, N = 2 mm; J = 1 mm; L = 0.25 mm.

Distribution and natural history.

Kwonkan linnaei is known from two populations, one in Durokoppin Nature Reserve in the south, and the other in East Yorkrakine Nature Reserve in the north, both in the central Avon Wheatbelt bioregion, roughly 25 km due north of the town of Kellerberrin.

Remarks.

Males of this species appear to mature and disperse in autumn in search of females, with many specimens collected between March and June. Many of the paratypes designated by Main (2008) could not be located in the WAM collection, despite the donation of the B.Y. Main collection to the museum. These specimens were, presumably, never formally accessioned. However, all missing paratypes are from the type locality, and fortunately the holotype and an adequate selection of paratypes from this locality were available for examination.

4.9. Kwonkan moriartii Main, 1983

Figures 3A, 17

Kwonkan moriartii Main, 1983: 930, figs 31, 35, 39, 43, 45.

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♂; Kathleen Valley Station, via Wiluna; 27°24'S 120°39'E; 13 Jan 1962; T. Moriarty leg.; collected by hand (WAM T15236 [WAM 82/1360]).

Diagnosis.

Kwonkan moriartii does not occur near any other described species in the central Murchison bioregion, however the closest species geographically is K. goongarriensis, to the south (Fig. 3A). — Males of K. moriartii can be distinguished from K. goongarriensis by the presence of a thicker metatarsus I, with a more pronounced proximal excavation (metatarsus I thinner, straighter, and with a very subtle proximal excavation in K. goongarriensis) (Fig. 17Q; cf. Fig. 14Q), and further by the presence of a distinct distal bend in the embolus in prolateral view (embolus curving gradually in K. goongarriensis) (Fig. 17L; cf. Fig. 14L). — Females of K. moriartii are unknown.

Figure 17.

Kwonkan moriartii ♂ holotype (WAM T15236). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left pedipalp, full prolateral view (J), partial retrolateral view (K). L, M Left copulatory organ (images reflected), prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Description.

holotype male (WAM T15236). General: Body length 12.04; in poor condition, ventral prosoma and abdomen deformed, leg I broken (Fig. 17A–Q). — Dorsal prosoma: Carapace length 4.66; width 3.68; length/width 1.27; carapace orange; glabrous; fovea slightly recurved, with a medial cleft; fovea width / carapace length 0.12 (Fig. 17A, F). Chelicerae orange; rastellum of short, strong setae, on a slight mound (Fig. 17A, G). Eye group rectangular; width/length 2; eye tubercle present (Fig. 17E). — Abdomen: Length 5.4; pale laterally and ventrally, grey-brown dorsally (Fig. 17B, D). — Ventral prosoma: Labium cuspules absent (Fig. 17G, H). Maxillae with distinct heel; with about 30 cuspules extending posteriorly onto heel and laterally about 35% of maxillae length (Fig. 17C, G). Sternum length/width 1.28; central sternum with covering of short length hair-like setae (Fig. 17H). Posterior sigilla ovoid, inconspicuous; length / sternum length 0.12 (Fig. 17H). Other sigilla small, round and lateral (Fig. 17H). — Leg I: Orange-brown, darker on patella, tibia, and proximal metatarsus; femur length 4.56; patella length 2.68; tibia length 3.72; metatarsus length 3.23; tarsus length 1.95; total length 16.13; leg I length / carapace length 3.46 (Fig. 17N–Q). Scopulae very light on distal metatarsus and tarsus (Fig. 17N, O). Spine count Fe D several spine-like setae; Fe PL 2 (proximal missing); Pa PL 1 (missing); Ti PL 1 (ventral); Ti RL 0; Me PL 0; Me RL 0; Ta 0 (Fig. 17N–Q). Tibia I length/width [TIL/TID] 4.12; even width along length; tibial spur present; spur with single megaspine; spur subdigitiform; megaspine on spur angled at 23° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.75; spur height/tibia width [TISH/TID] 0.44; megaspine length / tibia length 0.21 (Fig. 17N–P). Metatarsus I slightly sinuous; proximal excavation concave, distal pad with slight, rounded heel; excavation length / metatarsus length [MIPEL/MIL] 0.33; metatarsus length/width [MIL/MID] 5.73 (Fig. 17N, O, Q). — Leg III: Prolateral spine count Fe 3; Pa 3; Ti 5; Me 5; Ta 2 (Fig. 17I). — Pedipalp: Tibia length 1.99; width 1.00; length/width [PTL/PTD] 1.99; asetose depression absent; retroventral spine-patch present; consisting of about 30 short spines; positioned about 50% of the way along the tibia (Fig. 17J, K). Femur with 1 (Fig. 17J). Patella prolateral face with row of 1 (missing) (Fig. 17J). Cymbium with scopula present distally (Fig. 17J, K). Copulatory organ length / pedipalp tibia length 0.45 (Fig. 17J–M). Bulb length/width 1.06 (Fig. 17L, M). Embolus demarcated from bulb; projecting and curving so as to form an angle of roughly 121° with bulb; embolus width at base / bulb width 0.33; embolus length / bulb length 0.97 (Fig. 17L, M).

Distribution and natural history.

Kwonkan moriartii is known from a single specimen, despite quite extensive sampling of the genus in the region (JDW unpublished data). The specimen was collected in the central-eastern part of the Murchison bioregion, about 50 km due north of Leinster in what is now Wanjarri Nature Reserve. Nothing is currently known about the natural history of this species.

Remarks.

The male specimen was collected in January, suggesting males might mature and disperse to search for females in summer.

4.10. Kwonkan silvestris Main, 1983

Figures 2, 3A, 18, 19

Kwonkan silvestre Main, 1983: 930, figs 9, 13, 26, 32, 36, 40, 44.

Kwonkan silvestris Main: Harvey et al., 2023a, 2 (following ICZN, assigned masculine gender to the genus and changed this specific epithet accordingly).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♂; Juranda; 33°13'S 123°27'E; 12 Dec. 1953; B. Y. Main leg.; collected by hand (WAM T15232 [WAM 82/1356]). — Allotype: AUSTRALIA: Western Australia. • 1 female; 88 km E. of Norseman; 32°12'S 123°17'E; 08 Dec. 1953; B. Y. Main leg.; collected by hand (WAM T15233 [WAM 82/1357]). — Paratypes: AUSTRALIA: Western Australia. • 1 ♂; Balladonia (Magooinya); 32°27'S 123°52'E; 10 Dec. 1953; B. Y. Main leg. (WAM T155866 [BYM 53/517]) • 1 ♂; Fraser Range (78 miles E. of Norseman); 32°02'S 122°48'E; 09 Dec. 1953; B. Y. Main leg. (WAM T155867 [BYM 53/514]). — Other material examined: AUSTRALIA: Western Australia. • 1 ♂; Cape Arid National Park, Pine Hill south; 33°18'S 123°22'E; 26 Oct. 2006; S. Comer et. al. leg. (WAM T95098) • 1 ♂; Mt Henry, ca. 17 km S. of Norseman; 32°20'46.9"S 121°47'22.9"E; 09 Dec. 2012–09 Dec. 2012; M. K. Curran and S. R. Bennett leg.; hand foraging (WAM T130489).

Diagnosis.

Kwonkan silvestris occurs near K. currycomboides and K. turriger in the south-eastern agricultural zone of SWWA (Fig. 3A). — Both sexes can be distinguished from K. currycomboides by the absence of spine patches on ventral coxae III and IV (spine patches present in K. currycomboides) (Figs 18C, 19C; cf. Figs 9C, 10C). — Females of K. silvestris can be distinguished from those of K. turriger by the presence of spines on at least some of their leg tarsi (tarsal spines absent in K. turriger) (Fig. 19A, I–L; cf. Fig. 20A, I–L). — Males of K. silvestris cannot be distinguished from those of K. turriger because males of the latter are unknown.

Figure 18.

Kwonkan silvestris ♂ holotype (WAM T15232). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Right pedipalp (images reflected), full prolateral view (J), partial retrolateral view (K). L, M Left copulatory organ (images reflected), prolateral (L) and dorsal view (M). N–Q Left leg I, full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Figure 19.

Kwonkan silvestris ♀ allotype (WAM T15233). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.5 mm.

Figure 20.

Kwonkan turriger ♀ holotype (WAM T26692). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left leg I, prolateral view (J), retrolateral view (K). L Spermathecae (cleared in lactic acid), dorsal view. Scale bars: A, B, J = 2 mm; L = 0.25 mm.

Description holotype male (WAM T15232).

General: Body length 10.11; in good condition (Fig. 18A–Q). — Dorsal prosoma: Carapace length 5.39; width 4.65; length/width 1.16; carapace orange; glabrous; fovea procurved, with a medial cleft; fovea width / carapace length 0.14 (Fig. 18A, F). Chelicerae orange; rastellum of short, strong setae, not on a mound (Fig. 18A, G). Eye group rectangular; width/length 2.21; eye tubercle present (Fig. 18E). — Abdomen: Length 2.78; light brown (Fig. 18B, D). — Ventral prosoma: Labium cuspules absent (Fig. 18G, H). Maxillae with distinct heel; with about 90 cuspules extending posteriorly onto heel and laterally about 45% of maxillae length (Fig. 18C, G). Sternum length/width 1.27; central sternum with covering of short length hair-like setae (Fig. 18H). Posterior sigilla elongate; length / sternum length 0.19 (Fig. 18H). Other sigilla small, round and lateral (Fig. 18H). — Leg I: Light orange, darker on patella, tibia, and proximal metatarsus; femur length 5; patella length 2.85; tibia length 3.97; metatarsus length 4.72; tarsus length 2.35; total length 18.88; leg I length / carapace length 3.5 (Fig. 18N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 18N, O). Spine count Fe D several bristle-like setae; Fe PL 2; Pa PL 2; Ti PL 3; Ti RL 2; Me PL 1; Me RL 0; Ta 0 (Fig. 18N–Q). Tibia I length/width [TIL/TID] 4.05; even width along length; tibial spur present; spur with single megaspine; spur subdigitiform; megaspine on spur angled at 22° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.6; spur height / tibia width [TISH/TID] 0.61; megaspine length / tibia length 0.27 (Fig. 18N–P). Metatarsus I slightly sinuous; proximal excavation concave, distal pad with slight, rounded heel; excavation length / metatarsus length [MIPEL/MIL] 0.32; metatarsus length/width [MIL/MID] 7.75 (Fig. 18N, O, Q). — Leg III: Prolateral spine count Fe 3; Pa 7; Ti 8; Me 15; Ta 6 (Fig. 18I). — Pedipalp: Tibia length 2.25; width 0.95; length/width [PTL/PTD] 2.36; asetose depression absent; retroventral spine-patch present; consisting of about 18 long spines; positioned about 50% of the way along the tibia (Fig. 18J, K). Femur with 1 (Fig. 18J). Patella prolateral face with row of 1 (Fig. 18J). Cymbium with scopula present distally (Fig. 18J, K). Copulatory organ length / pedipalp tibia length 0.48 (Fig. 18J–M). Bulb length/width 1.04 (Fig. 18L, M). Embolus demarcated from bulb; projecting and curving so as to form an angle of roughly 111° with bulb; embolus width at base / bulb width 0.37; embolus length / bulb length 1.38 (Fig. 18L, M).

Description allotype female (WAM T15233).

General: Body length 17.02; in moderate condition, carapace and genital plate damaged (Fig. 19A–L). — Dorsal prosoma: Carapace length 5.72; width 5.2; length/width 1.1; carapace pale yellow; glabrous; fovea procurved; fovea width / carapace length 0.21 (Fig. 19A, F). Chelicerae red-brown; rastellum of short, strong thorn-like setae on mound (Fig. 19A, G). Eye group rectangular; width/length 2.13; eye tubercle present (Fig. 19E). — Abdomen: Length 8.14; white (Fig. 19B, D). — Ventral prosoma: Labium cuspules absent (Fig. 19G, H). Maxillae with distinct heel; with about 60 cuspules extending posteriorly onto heel and laterally about 80% of maxilla length, blending into spines laterally (Fig. 19C, G). Sternum length/width 1.2; central sternum with covering of moderate length, hair-like setae (Fig. 19H). Posterior sigilla elongate, inconspicuous; length / sternum length 0.18 (Fig. 19H). Other sigilla small, round and lateral (Fig. 19H). — Leg I: Dark red-brown; femur length 5.07; patella length 2.92; tibia length 3.33; metatarsus length 3; tarsus length 2.07; total length 16.38; leg I length / carapace length 2.86 (Fig. 19J, K). Scopulae on metatarsus and tarsus (Fig. 19J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 2; Ti PL 3; Ti RL 4; Me PL 3; Me RL 4; Ta 0 (Fig. 19J, K). Tibia I length/width [TIL/TID] 3.02 (Fig. 19J, K). — Leg III: Prolateral spine count Fe 3; Pa 6; Ti 7; Me 12; Ta 4 (Fig. 19I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 19D, L). Spermathecae with two vesicles each (Fig. 19L). Lateral vesicles relatively straight; angled medially; with distinct, wide and flattened crowns; lateral vesicle length 0.32; lateral vesicle length / genitalia width 0.26; lateral vesicle width at base / genitalia width 0.21; lateral vesicle length / width at base 1.23 (Fig. 19L). Medial vesicles projecting medially from base of lateral vesicle; small and rounded; crown distinct, rounded; medial vesicle length / genitalia width 0.15; medial vesicle length / lateral vesicle length 0.59 (Fig. 19L).

Distribution and natural history.

Kwonkan silvestris is known from several locations over a relatively large area in the south-eastern part of the Coolgardie bioregion, from the northern limit of Cape Arid National Park in the south, to Balladonia in the east and Dundas in the west, with Fraser Range being the most northerly collecting locality. In the etymology of the original description, Main (1983, 930) alludes to the species occurring in “low, open woodlands”. Nothing else is currently known about the natural history of this species.

Remarks.

Males of this species appear to mature and disperse to search for females in late spring and summer, from October to December. Specimens here associated with K. silvestris were previously known by the WAM codes ‘MYG122’ and ‘MYG905’.

COI barcode sequence (WAM T130489).

AACTTTGTATTTGTTATTCGGGGTTTGATCAGCTATAGTAGGAACTGGAATGAGAGTTATTATTCGGACTGAGTTGGGTCAGGTAGGGAGATTGTTGGGGGATGATCATTTATATAATGTTGTGGTAACGGCTCATGCTTTGGTGATGATTTTTTTTATAGTAATGCCTATTATAATTGGAGGGTTTGGGAATTGGTTGGTTCCTCTTATATTAGGTGCTCCTGATATGGCTTTTCCTCGGATAAATAATTTGAGTTTTTGGTTGTTACCTCCTTCTTTGTTTTTATTAGTATTGTCGTCTTTGACGGATGTTGGTGTTGGGGCTGGATGGACTATTTATCCTCCTTTGTCTTCTGTTGTTGGGCATGGTGGTGGAGGAATGGATTTTGCCATTTTTTCTTTGCATTTAGCTGGAGCTTCTTCAATTATGGGAGCTATTAATTTTATTACTACTATTGTAAATATACGTATGGTGGGTATAACTATGGAGCGTGTTCCTTTATTTGTATGGTCTGTTTTAATTACTGCTGTTTTGTTGTTGTTATCTTTACCTGTTTTGGCTGGTGCTATTACTATATTATTGACGGATCGGAATTTTAATACATCATTTTTTGATCCTGCGGGAGGGGGAGATCCTATTTTATTTCAACATTTATTT.

4.11. Kwonkan turriger (Main, 1994)

Figures 1G, 1H, 2, 3A, 20

Aname turrigera Main, 1994: 65, fig. 1a-k.

Kwonkan turrigera (Main): Harvey et al., 2018, 442 (transferred from Aname).

Kwonkan turriger (Main): Harvey et al., 2023a, 2 (following ICZN, assigned masculine gender to the genus and changed the specific epithet of this species accordingly).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♀; 24 km W. of Balladonia on Eyre Highway; 32°14'S 123°24'E; 20 Nov. 1986; B. Y. Main leg.; excavated from burrow (WAM T26692 [WAM 92/2629]). — Paratypes: AUSTRALIA: Western Australia. • 1 ♀; same data as holotype (WAM T26693 [WAM 92/2630]) • 1 ♀; same data (WAM T155747 [BYM 86/175]) • 1 ♀; same data (WAM T155748 [BYM 86/176]) • 1 ♀; same data (WAM T155749 [BYM 86/177])• 1 ♀; same data except 24 May 1986 (WAM T155750 [BYM 86/157]) • 1 ♀; same data (WAM T155751 [BYM 86/158]) • 1 ♀, 10 juveniles; same data (WAM T155752 [BYM 86/159]) • 1 ♀; Mallura; 21 Aug. 1960; A. R. Main leg.; excavated from burrow (WAM T155753 [BYM 60/19]). South Australia. • 1 ♀; Yalata; 31°30'S 131°50'E; 20 May 1986; B. Y. Main leg.; excavated from burrow (WAM T155798 [BYM 86/110]) • 1 juvenile; Yalata Swamp, Head of the Bight; 31°26'S 131°11'E; 20 May 1986; B. Y. Main leg.; excavated from burrow (WAM T155760 [BYM 86/109]). — Other material examined: AUSTRALIA: Western Australia. • 1 ♀; 23.4 km NW. of Balladonia Roadhouse, Eyre Highway; 32°14'19"S 123°24'15"E; 234 m; 28 Aug. 2014; S. E. Harrison and M. S. Harvey leg.; dug from aerial tube in Triodia (WAM T134203) • 1 juvenile; same data (WAM T134204) • 1 ♀; 24 km W. of Balladonia; 32°14'20.1"S 123°24'15.2"E; 230 m; 17 Sep. 2017; M. J. Hillyer and J. M. Waldock leg.; dug from aerial tube in Triodia (WAM T144417) • 1 juvenile; same data except 32°14'21.0"S 123°24'14.2"E; 232 m (WAM T144418) • 1 ♀; 25 km W. of Balladonia on Eyre Highway; 32°14'S 123°24'E; 24 Nov. 1987; B. Y. Main leg.; dug from aerial tube in Triodia (WAM T155762) • 1 juvenile; 25 km W. of Balladonia on Eyre Highway; 32°14'S 123°24'E; 24 Nov. 1987; B. Y. Main leg.; dug from aerial tube in Triodia (WAM T155763).

Diagnosis.

Kwonkan turriger occurs near K. anatolion and K. elatus sp. nov. on the eastern (South Australian) side of the Nullarbor Plain, and near K. silvestris and K. currycomboides on the western (Western Australian) side (Fig. 3A). — Both sexes of K. turriger can be distinguished from those of K. currycomboides by the absence of spine patches on ventral coxae III and IV (spine patches present in K. currycomboides) (Figs 20C; cf. Figs 9C, 10C). — Females of K. turriger can be distinguished from those of K. anatolion and K. silvestris by the absence of spines on their leg tarsi (tarsal spines present on at least some legs of K. anatolion and K. silvestris) (Fig. 20I; cf. Figs 8I, 19I). They can be distinguished from K. elatus sp. nov. by the presence of shorter lateral spermathecal receptacles (Fig. 20L; cf. Fig. 13L). — Males of K. turriger are unknown.

Description holotype female (WAM T26692).

General: Body length 14.78; in good condition, abdomen slightly deformed (Fig. 20A–L). — Dorsal prosoma: Carapace length 4.86; width 3.71; length/width 1.31; carapace orange; glabrous; fovea procurved, with a feint medial cleft; fovea width / carapace length 0.17 (Fig. 20A, F). Chelicerae orange; rastellum of short, strong thorn-like setae on mound (Fig. 20A). Eye group rectangular; width/length 2.38; eye tubercle present (Fig. 20C). — Abdomen: Length 7.03; white laterally and ventrally, with dark brown, thin chevrons dorsally (Fig. 20B, D). — Ventral prosoma: Labium cuspules absent (Fig. 20G, H). Maxillae with distinct heel; with about 50 cuspules; cuspules extending posteriorly onto heel; extending laterally about 30% of maxillae length (Fig. 20C, G). Sternum length/width 1.05; central sternum with covering of moderate length, hair-like setae (Fig. 20H). Posterior sigilla ovoid; length / sternum length 0.13 (Fig. 20H). Other sigilla small, round and lateral (Fig. 20H). — Leg I: Pale; femur length 3.52; patella length 2.25; tibia length 2.29; metatarsus length 1.92; tarsus length 1.47; total length 11.45; leg I length / carapace length 2.35 (Fig. 20J, K). Scopulae on metatarsus and tarsus (Fig. 20J, K). Spine count Fe D several bristle-like setae; Fe PL 1; Pa PL 1; Ti PL 2; Ti RL 4; Me PL 3; Me RL 4; Ta 0 (Fig. 20J, K). Tibia I length/width [TIL/TID] 2.68 (Fig. 20J, K). — Leg III: Prolateral spine count Fe 0; Pa 3; Ti 5; Me 8; Ta 0 (Fig. 20I). — Genitalia: Epigastric furrow gently curving, without modification (Fig. 20D, L). Spermathecae with two vesicles each (Fig. 20L). Lateral vesicles relatively straight; angled medially; with indistinct rounded crowns; lateral vesicle length 0.18; lateral vesicle length / genitalia width 0.21; lateral vesicle width at base / genitalia width 0.18; lateral vesicle length / width at base 1.19 (Fig. 20L). Medial vesicles projecting medially from base of lateral vesicle; small and rounded; crown distinct, rounded; medial vesicle length / genitalia width 0.08; medial vesicle length / lateral vesicle length 0.38 (Fig. 20L).

Distribution and natural history.

Kwonkan turriger, after being relimited in this revision, is known from two populations occurring on either side of the Nullarbor Plain (Fig. 3A). One population is at the type locality, west of the town of Balladonia in the eastern part of the Coolgardie bioregion of Western Australia. The second population, tentatively ascribed to the same species based on female genital morphology, occurs near Yalata, in the coastal swampy region east of the Nullarbor Plain, in the Nullarbor bioregion of South Australia. Specimens from further east, previously ascribed to K. turriger, are now recognised as the new species K. elatus sp. nov. The burrows of K. turriger and its sister species K. elatus sp. nov. are unique among anamids in extending above the substrate as a soil turret, which may be free-standing or project into and open within low foliage (typically spinifex or chenopod shrubs; Fig. 1G, H). More detailed information on the burrow structure and life history of K. turriger sensu lato (as then circumscribed, and now comprising the two aforementioned species) is provided in Main (1994).

Remarks.

This species was first described as Aname turrigera by Main (1994) and assigned to the genus Aname mostly by the lack of spines on the leg tarsi. Harvey et al. (2018) used molecular data to suggest that it was a species of Kwonkan.

COI barcode consensus sequence (N = 4).

AACTTTGTATTTGATATTTGGGGTATGATCTGCTATGGTGGGTACTGCTATAAGAGTTATTGTACGCACAGAGTTGGGTCAAGTTGGGAGATTATTAGGAGATGATCATTTGTATAATGTAATAGTAACGGCGCATGCTTTGGTGATGATTTTTTTTATAGTGATGCCTATTATGATTGGAGGGTTTGGTAATTGATTAGTTCCTTTGATATTAGGAGCGCCGGATATAGCATTTCCTCGGATGAATAATTTAAGATTTTGATTATTGCCTCCTTCCTTATTTATGTTGGTTTTGTCATCATTGACGGATGTAGGGGTGGGGGCTGGATGAACAATTTATCCCCCTTTGTCTTCAGGTATAGGGCATAGAGGAGGGGGTATAGATTTTGTTATTTTTTCTTTACATTTGGTTGGGGTTTCTTCTATTATGGGGGCTATTAATTTTATTACGACTATTAAGAATATACGTATGATGGGGATAACAATGGAACGTGTTCCTCTCTTTGTTTGATCTGTTTTAATTACTGCTGTATTGTTGTTGTTGTCTTTACCAGTTTTGGCGGGTGCTGTTACTATATTATTGACCGATCGAAATTTTAATACATCGTTTTTTGATCCTGCTGGTGGGGGGGATCCTATTTTGTTTCAACATTTATTT.

4.12. Kwonkan yorkrakine sp. nov.

https://zoobank.org/985D2568-7491-4B93-A1D5-0A471E79BB88

Figures 3B, 21

Kwonkan eboracum Main, 1983: 929, figs 27, 33, 37, 41 (in part, male allotype WAM 82/1359 [WAM T15235]).

Material examined.

Holotype: AUSTRALIA: Western Australia. • ♂; [K. eboracum allotype]; Yorkrakine Rock Nature Reserve, Yorkrakine Rock, E. of Tammin; 31°25'S 117°31'E; 01 Jan 1969; R. Jones leg.; collected by hand (WAM T15235 [WAM 82/1359]). — Paratype: AUSTRALIA: Western Australia. •4 ♂♂; McClellands [remnant next to Hanlon Rd, between McClelland Rd in the north and McLellan Rd in the south], remnant 49, quadrat T25-30; 31°34'40"S 117°37'58"E; 08 Dec. 1987; G. T. Smith leg.; dry pitfall trap (WAM T144981).

Diagnosis.

Kwonkan yorkrakine sp. nov. occurs near K. eboracum, K. linnaei, and K. wonganensis in the central Avon Wheatbelt bioregion (Fig. 3B). — Both sexes can be distinguished from K. linnaei by the absence of spine patches on coxae III and IV (spine patches present in K. linnaei) (Fig. 21C; cf. Fig. 16C). — Males of K. yorkrakine sp. nov. can be distinguished from those of K. eboracum and K. wonganensis by the presence of shorter, stouter spines on pedipalp tibia (spines longer and thinner in K. eboracum and K. wonganensis) (Fig. 21K; cf. Figs 6K, 11K) and a shorter embolus (embolus longer relative to bulb in K. eboracum and K. wonganensis) (Fig. 21L; cf. Figs 6L, 11L). — Females of K. yorkrakine sp. nov. are unknown.

Figure 21.

Kwonkan yorkrakine sp. nov. ♂ holotype (WAM T15235). A Cephalothorax, dorsal view. B Abdomen, dorsal view. C Cephalothorax, ventral view. D Abdomen, ventral view. E Ocular region, dorsal view. F Fovea, dorsal view. G Mouthparts, ventral view. H Sternum and labium, ventral view. I Right leg III, prolateral view. J, K Left pedipalp, full prolateral view (J), partial retrolateral view (K). L, M Right copulatory organ, prolateral (L) and dorsal view (M). N–Q Right leg I (images reflected), full prolateral view (N), full retrolateral view (O), tibia, retrolateral view (P), metatarsus, retrolateral view (Q). Scale bars: A, B, J, N = 2 mm; L = 0.5 mm.

Etymology.

The specific epithet ‘yorkrakine’ is a noun in apposition, referencing the type locality of the species, at Yorkrakine Rock Nature Reserve.

Description holotype male (WAM T15235).

General: Body length 11.6; in poor condition, prosoma and abdomen deformed, colour faded (Fig. 21A–Q). — Dorsal prosoma: Carapace length 4.54; width 3.21; length/width 1.41; carapace yellow; glabrous; fovea straight; fovea width / carapace length 0.13 (Fig. 21A, F). Chelicerae yellow-brown; rastellum of short, strong setae, not on a mound (Fig. 21A). Eye group rectangular; width/length 2; eye tubercle present (Fig. 21C). — Abdomen: Length 4.95; pale (Fig. 21B, D). — Ventral prosoma: Labium cuspules absent (Fig. 21G, H). Maxillae with distinct heel; with about 70 cuspules; cuspules extending posteriorly onto heel; extending laterally about 50% of maxillae length (Fig. 21C, G). Sternum length/width 1.25; central sternum with covering of very short length hair-like setae (Fig. 21H). Posterior sigilla faded, inconspicuous (Fig. 21H). — Leg I: Yellow, darker on patella, tibia, and proximal metatarsus; femur length 3.92; patella length 2.13; tibia length 2.91; metatarsus length 3.2; tarsus length 1.97; total length 14.14; leg I length / carapace length 3.12 (Fig. 21N–Q). Scopulae light on distal metatarsus and tarsus (Fig. 21N, O). Spine count Fe D 1; Fe PL 2; Pa PL 2; Ti PL 1; Ti RL 1; Me PL 0; Me RL 1; Ta 0 (Fig. 21N–Q). Tibia I length/width [TIL/TID] 3.36; even width along length; tibial spur present; spur with single megaspine; spur triangular; megaspine on spur angled at 34° relative to tibia; length to distal face of spur / tibia length [TIS/TIL] 0.61; spur height / tibia width [TISH/TID] 0.48; megaspine length / tibia length 0.32 (Fig. 21N–P). Metatarsus I straight; proximal excavation inconspicuous; excavation length / metatarsus length [MIPEL/MIL] 0.37; metatarsus length/width [MIL/MID] 5.77 (Fig. 21N, O, Q). — Leg III: Prolateral spine count Fe 3; Pa 6; Ti 8; Me 12; Ta 4 (Fig. 21I). — Pedipalp: Tibia length 1.67; width 0.8; length/width [PTL/PTD] 2.07; asetose depression absent; retroventral spine-patch present; consisting of about 20 short spines; positioned about 45% of the way along the tibia (Fig. 21J, K). Femur with 1 (Fig. 21J). Patella prolateral face with row of 1 (Fig. 21J). Cymbium with scopula present distally (Fig. 21J, K). Copulatory organ length / pedipalp tibia length 0.49 (Fig. 21J–M). Bulb length/width 1.08 (Fig. 21L, M). Embolus demarcated from bulb; projecting and curving so as to form an angle of roughly 120° with bulb; embolus width at base / bulb width 0.38; embolus length / bulb length 1.1 (Fig. 21L, M).

Distribution and natural history.

Kwonkan yorkrakine sp. nov. is known from two localities in the central Avon Wheatbelt bioregion, in the vicinity of the towns of Tammin and Kellerberrin. Nothing is currently known about the burrow constructed by this species.

Remarks.

The five males of this species represented in collections were collected in December and January, suggesting that males mature and disperse to search for females in summer.

5. Declarations

Authors’ Contributions. Jeremy Wilson: conceptualisation, funding acquisition, project administration, data curation, formal analyses, figure generation, writing (original draft preparation). — Arianna Urso: data curation, figure generation, writing (reviewing and editing). — Michael Rix: mentorship, writing (reviewing and editing). — Erich Volschenk: photos and natural history information, writing (reviewing and editing). — Mark Harvey: project administration, funding acquisition, mentorship, data curation, writing (reviewing and editing).

Conflict of interest. The authors do not have any conflict of interest to declare.

6. Acknowledgements

We thank Julianne Waldock, Collection Manager of Arachnids and Myriapods at the Western Australian Museum (WAM), for managing the WAM Kwonkan collection over many years. We are grateful to the many scientists who collected specimens included in this revision, particularly those involved in the government-led surveys conducted as part of the Salinity Action Plan (see Keighery 2004), which resulted in the collection of numerous key Kwonkan specimens from across the south-west Western Australian agricultural region. This study was supported financially by a Bush Blitz 2024 Taxonomy Research Project (DNP BCK-2324-030-F) on Kwonkan, and by an ABRS National Taxonomy Postdoctoral Fellowship (4-H3KOG-BR) on the Anamidae.

7. References

Castalanelli MA, Framenau VW, Huey JA, Hillyer MJ, Harvey MS (2020) New species of the open-holed trapdoor spider genus Aname (Araneae: Mygalomorphae: Anamidae) from arid Western Australia. The Journal of Arachnology 48: 169–213. https://doi.org/10.1636/0161-8202-48.2.169

Harvey MS (2002) Short-range endemism amongst the Australian fauna: some examples from non-marine environments. Invertebrate Systematics 16: 555–570. https://doi.org/10.1071/IS02009

Harvey MS, Wilson JD, Rix MG (2023a) Three new species of the open-holed trapdoor spider genus Kwonkan (Mygalomorphae: Anamidae) from central Australia. Australian Journal of Taxonomy 21: 1–9. https://doi.org/10.54102/ajt.l6he8

Harvey MS, Wilson JD, Rix MG (2023b) Two new species of the open-holed trapdoor spider genus Proshermacha (Araneae: Mygalomorphae: Anamidae) from southern Western Australia. Australian Journal of Taxonomy 43: 1–13. https://doi.org/10.54102/ajt.2k58g

Harvey MS, Rix MG, Hillyer MJ, Huey JA (2020) The systematics and phylogenetic position of the troglobitic Australian spider genus Troglodiplura (Araneae: Mygalomorphae), with a new classification for Anamidae. Invertebrate Systematics 34: 799–822. https://doi.org/10.1071/IS20034

Harvey MS, Hillyer MJ, Main BY, Moulds TA, Raven RJ, Rix MG, Vink CJ, Huey JA (2018) Phylogenetic relationships of the Australasian open-holed trapdoor spiders (Araneae: Mygalomorphae: Nemesiidae: Anaminae): multi-locus molecular analyses resolve the generic classification of a highly diverse fauna. Zoological Journal of the Linnean Society 184: 407–452. https://doi.org/10.1093/zoolinnean/zlx111

Hopper SD, Gioia P (2004) The southwest Australian floristic region: evolution and conservation of a global hot spot of biodiversity. Annual Reviews in Ecology, Evolution, and Systematics 35: 623–650. https://doi.org/10.1146/annurev.ecolsys.35.112202.130201

Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010

Keighery GJ (2004) State Salinity Strategy biological survey of the Western Australian wheatbelt: background. Records of the Western Australian Museum Supplement 67: 1–6. https://doi.org/10.18195/issn.0313-122x.67.2004.001-006

Laurance WF, Dell B, Turton SM, Lawes MJ, Hutley LB, McCallum H, Dale P, Bird M, Hardy G, Prideaux G, Gawne B, McMahon CR, Yu R, Hero J-M, Schwarzkopf L, Krockenberger A, Douglas M, Silvester E, Mahony M, Vella K, Saikia U, Wahren C-H, Xu Z, Smith B, Cocklin C (2011) The 10 Australian ecosystems most vulnerable to tipping points. Ecoregional-scale monitoring within conservation areas, in a rapidly changing climate 144: 1472–1480. https://doi.org/10.1016/j.biocon.2011.01.016

Maddison WP, Whitton J (2023) The species as a reproductive community emerging from the past. Bulletin of the Society of Systematic Biologists 2: 1–35. https://doi.org/10.18061/bssb.v2i1.9358

Main BY (1977) Spiders. In: The Natural History of the Wongan Hills. Western Australian Naturalists Club, Perth, pp. 100–107.

Main BY (1983) Further studies on the systematics of Australian Diplurinae (Chelicerata: Mygalomorphae: Dipluridae): two new genera from south western Australia. Journal of Natural History 17: 923–949. https://doi.org/10.1080/00222938300770731

Main BY (1986) Further studies on the systematics of Australian Diplurinae (Araneae: Mygalomorphae: Dipluridae): a new genus from south-western Australia. Records of the Western Australian Museum 12: 395–402.

Main BY (1994) Biosystematics of Australian mygalomorph spiders: description of a new species of Aname and its aerial tube (Araneae: Nemesiidae). Journal of the Royal Society of Western Australia 77: 65–69.

Main BY (2008) A new species of the mygalomorph spider genus Yilgarnia from the Western Australian wheatbelt (Araneae: Nemesiidae). Records of the Western Australian Museum 24: 321–324.

Minh BQ, Nguyen MAT, von Haeseler A (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30: 1188–1195. https://doi.org/10.1093/molbev/mst024

Moir ML, Young DA (2023) Insects from the southwest Australia biodiversity hotspot: a barometer of diversity and threat status of nine host-dependent families across three orders. Journal of Insect Conservation 27: 3–18. https://doi.org/10.1007/s10841-022-00443-x

Moir ML, Brennan KE, Harvey MS (2009) Diversity, endemism and species turnover of millipedes within the south-western Australian global biodiversity hotspot. Journal of Biogeography 36(10): 1958–1971. https://doi.org/10.1111/j.1365-2699.2009.02137.x

Nguyen L-T, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300

Prober SM, Smith FP (2009) Enhancing biodiversity persistence in intensively used agricultural landscapes: a synthesis of 30 years of research in the Western Australian wheatbelt. Agriculture, Ecosystems & Environment 132: 173–191. https://doi.org/10.1016/j.agee.2009.04.005

Rix MG, Wilson JD, Harvey MS (2023) A revision of the open-holed trapdoor spiders of the Teyl damsonoides-group (Mygalomorphae: Anamidae: Teylinae) from south-western Australia. The Journal of Arachnology 51: 287–377. https://doi.org/10.1636/JoA-S-21-077

Rix MG, Huey JA, Cooper SJ, Austin AD, Harvey MS (2018a) Conservation systematics of the shield-backed trapdoor spiders of the nigrum-group (Mygalomorphae, Idiopidae, Idiosoma): integrative taxonomy reveals a diverse and threatened fauna from south-western Australia. ZooKeys 756: 1. https://doi.org/10.3897/zookeys.756.24397

Rix MG, Raven RJ, Austin AD, Cooper SJ, Harvey MS (2018b) Systematics of the spiny trapdoor spider genus Bungulla (Mygalomorphae: Idiopidae): revealing a remarkable radiation of mygalomorph spiders from the Western Australian arid zone. The Journal of Arachnology 46: 249–344. https://doi.org/10.1636/JoA-S-17-057.1

Rix MG, Edwards DL, Byrne M, Harvey MS, Joseph L, Roberts JD (2015) Biogeography and speciation of terrestrial fauna in the south-western Australian biodiversity hotspot. Biological Reviews 90: 762–793. https://doi.org/10.1111/brv.12132

Rix MG, Huey JA, Main BY, Waldock JM, Harrison SE, Comer S, Austin AD, Harvey MS (2017) Where have all the spiders gone? The decline of a poorly known invertebrate fauna in the agricultural and arid zones of southern Australia. Austral Entomology 56: 14–22. https://doi.org/10.1111/aen.12258

Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44: 232–235. https://doi.org/10.1093/nar/gkw256

Wilson JD, Rix MG, Harvey MS (2025a) Two new species of the mygalomorph spider genus Kwonkan (Mygalomorphae: Anamidae) from the Kimberley region of Western Australia. Australian Journal of Taxonomy 88: 1–7. https://doi.org/10.54102/ajt.voay9

Wilson JD, Bond JE, Harvey MS, Ramírez MJ, Rix MG (2023) Correlation with a limited set of behavioral niches explains the convergence of somatic morphology in mygalomorph spiders. Ecology and Evolution 13: e9706. https://doi.org/10.1002/ece3.9706

Wilson JD, Rix MG, Hillyer MJ, Huey JA, Piccinini A, Redfern GC, Simmons LW, Volschenk ES, Harvey MS (2025b) Integrative taxonomy of the hooded wishbone spiders of the Aname mellosa-complex from Western Australia (Araneae: Mygalomorphae: Anamidae). Invertebrate Systematics 39: IS25012. https://doi.org/10.1071/IS25012

Woinarski JC, Braby MF, Gibb H, Harvey MS, Legge SM, Marsh JR, Moir ML, New TR, Rix MG, Murphy BP (2024) This is the way the world ends; not with a bang but a whimper: Estimating the number and ongoing rate of extinctions of Australian non-marine invertebrates. Cambridge Prisms: Extinction 2: e23. https://doi.org/10.1017/ext.2024.26

World Spider Catalog 2026. World Spider Catalog. Version 27. Natural History Museum Bern, online at http://wsc.nmbe.ch, accessed on 17 February 2026. https://doi.org/10.24436/2

Supplementary material

Supplementary material 1

File S1

Wilson JD, Urso A, Rix MG, Volschenk ES, Cruz Bedón V, Harvey MS (2026)

Data type: .xlsx

Explanation notes: Sequenced specimen information and GenBank accession numbers.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (21.04 kb)