Research Article |
|
Corresponding author: Lech Karpiński ( lechkarpinski@gmail.com ) Corresponding author: Wojciech T. Szczepański ( szczepanski.w@interia.pl ) Academic editor: Marianna Simões
© 2021 Lech Karpiński, Patrick Gorring, Lech Kruszelnicki, Denis G. Kasatkin, Wojciech T. Szczepański.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Karpiński L, Gorring P, Kruszelnicki L, Kasatkin DG, Szczepański WT (2021) A fine line between species and ecotype: a case study of Anoplistes halodendri and A. kozlovi (Coleoptera: Cerambycidae) occurring sympatrically in Mongolia. Arthropod Systematics & Phylogeny 79: 1-23. https://doi.org/10.3897/asp.79.e61499
|
This paper discusses ecological adaptation based on a case study of Anoplistes halodendri and Anoplistes kozlovi (Coleoptera: Cerambycidae) that occur in the arid zone of Mongolia. By applying an integrative taxonomy approach, we revealed one of the first documented cases of sympatrically occurring ecotypes in Polyphaga and the second case of ecotypes in the family Cerambycidae. The results of the analysis of the ecological data, molecular analysis of mitochondrial (COI) and nuclear (ArgK and CAD) genes, as well as a detailed morphological examination, which consisted of a study on the male genitalia including the endophallic structures, supported the hypothesis that these two entities, which are commonly considered separate species, represent only ecologically adapted forms that are associated with rocky hills and sandy/gravelly plains, respectively. Therefore, a synonym is restored: Anoplistes halodendri minutus Hammarström, 1892 = Asias kozlovi Semenov and Znojko, 1934, syn. res. The differences in the elytral pattern and shade appear to be adapted to the different substrates in these distinct habitats. A probable scenario assumes that these two forms arose in parapatry, independently in multiple populations, under parallel speciation during the intensification of the aridification across the region in the period during which the Gobi Desert was formed (~ 24 to 2.6 Ma) and they may evolve into separate species in the future. The phylogenetic relationships of some taxa representing the most closely related genera of the tribe Trachyderini were analysed and the questioned species status of Anoplistes jacobsoni was confirmed. Low interspecific differences in the endophallic structures in the genus Anoplistes and between some species of the genus Amarysius indicate that they are evolutionarily relatively young groups. The practical differences between ecotype and subspecies are also discussed.
Central Asia, Gobi Desert, integrative taxonomy, non-allopatric speciation, parallel speciation, phenotypic variation
It is commonly acknowledged that species represent a unique level of self-organising entities in nature. However, delineating species is controversial and the variety of the mechanisms of speciation make recognising species even more problematic. The process by which one species diverges into two distinct phylogenetic lineages is one of the main issues in biology. Although it is commonly accepted that speciation occurs across a continuum over time, the various points along the process need to be studied in order to understand the nature of this phenomenon, the role of the reproductive isolating barriers during speciation and the point at which the process is completed (
Adapting to different environmental conditions via divergent natural selection processes can generate phenotypic and genetic differences in the ecologically important characters between populations of the same species, which eventually may lead to the formation of a new species if the gene flow is negligible or absent (
The genus Anoplistes Audinet-Serville, 1833 (Cerambycidae: Cerambycinae: Trachyderini) is a relatively small taxonomic unit that comprises sixteen previously described species and several subspecies of Anoplistes halodendri (Pallas, 1773) (
The interesting observation of these two taxa within one extensive site—nearly sympatrically but yet clearly sticking to the two distinct habitats—during our 2019 entomological expedition to southeastern Mongolia triggered us to thoroughly study this issue. It seemed prudent to investigate whether these two entities that possibly began to adapt to the different environmental conditions, despite the possible mating that had been observed in the contact zone, had not yet developed barriers in their gene flow (reproductive isolation), which consequently resulted in stable, diagnostic differences that are strong enough to consider them to be separate species. Here, we integrate the morphological, molecular, and ecological data that are used to understand the evolutionary relationship between the two taxa in question, which are distributed within the arid zone of Mongolia.
Secondary aims of this study were to verify the species status of the morphologically very similar A. jacobsoni, which has been considered a subspecies or even a synonym of A. halodendri (
This study is based on an examination of ~ 570 specimens of Anoplistes halodendri minutus and A. kozlovi sensu
The individuals that were used for the detailed morphological and molecular analyses were collected by the authors during entomological expeditions to Kazakhstan (2017) and Mongolia (2019). Moreover, additional fresh material for the analyses was collected in SE Mongolia by Badamnyambuu Iderzorig (National University of Mongolia, Ulan Bator, Mongolia) earlier in 2019.
Individuals of two nearly sympatric populations of A. halodendri minutus and A. kozlovi sensu
The beetles were examined using an Olympus SZH10 Stereo Microscope at 7–140 × magnification and a PROLAB MSZ Stereo Microscope at 7–90 × magnification.
To examine the sclerotised parts of the male terminalia, the specimens were relaxed in distilled water for 12–24 h at room temperature. Then, the genitalia and last abdominal segment were separated from the other abdominal structures using pins and forceps (WTS, LKA) or a glass stick (DK) without removing the rest of the abdomen. The procedure for preparing the endophallus and the terminology for the endophallic structure were described in detail by
The scanning electron microscope (SEM) images were taken using a Hitachi S-3400N SEM at the Museum and Institute of Zoology, Polish Academy of Sciences.
Photographs of the habitus were taken with a Canon EOS 50D digital camera equipped with a Canon 100 mm f/2.8 USM Macro lens and a Canon MP-E 65 mm f/2.8 1–5 × lens. Photographs of the endophallus were taken with a Canon EOS 5D Mark III digital camera equipped with a Canon MP-E 65 mm f/2.8 1–5× lens. The images that were produced were stacked, aligned, and combined using Helicon Focus (www.heliconsoft.com) and Zerene Stacker (www.zerenesystems.com) software. Photographs of the cerambycids in nature, their host plants and habitats were taken with Canon EOS 550D, EOS 600D and Panasonic Lumix DMC-ZS3 cameras. All plates were prepared using Adobe Photoshop CS5 and GIMP 2.10.14.
The distribution of the species was illustrated using Quantum GIS (QGIS) 3.6.0 ‘Noosa’ and the raster layer was downloaded from OpenStreetMap (https://www.openstreetmap.org/). Additionally, Google’s close-up satellite images were downloaded from Google Earth. Geographical coordinates of the localities are given in WGS 84 format.
DNA barcoding, the analysis of a standardised segment of the mitochondrial cytochrome c oxidase subunit I (COI) gene, was performed on a representative selection of specimens of A. halodendri minutus (E Mongolia), A. kozlovi sensu
All of the laboratory work for extracting, purifying, amplifying and sequencing the DNA was performed at the “Canadian Centre for DNA Barcode” (CCDB, http://www.ccdb.ca), University of Guelph, Ontario, Canada, following the standard protocol (
Twenty specimens were successfully sequenced for a 590–658 bp long DNA barcoding fragment. The sequences were submitted to GenBank under the accession numbers MW506917–MW506936 (Table S1).
The obtained sequences and additional relevant information such as the specimen images, primers, gel images and trace files were uploaded to the “Barcode of Life Database” (BOLD, http://www.boldsystems.org) in the public online dataset “Anoplistes Central Asia LK” (DS-LKCCAA; DOI: dx.doi.org/10.5883/DS-LKCCAA). All of the voucher specimens reported herein are part of the BOLD project “LECHK Cerambycidae Central Asia L. Karpinski” and were deposited in the LK’s Cerambycid DNA-grade specimen bank at the Museum and Institute of Zoology, Polish Academy of Sciences (Warsaw, Poland).
We used the DNeasy column extraction kit (Qiagen) to extract DNA from ethanol preserved samples. Whole leg tissue was taken from adult beetles, dried to remove ethanol, and ground with a pestle before an overnight lysis incubation at 55C. DNA was eluted into 150ul of Qiagen buffer AE.
Two nuclear protein coding regions (ArgK and CAD) which regularly inform species boundaries in beetles (
| Gene | Primer Name | Direction | Sequence | Reference |
| COI | LCO1490 | F | GGTCAACAAATCATAAAGATATTGG |
|
| COI | HCO2198 | R | TAAACTTCAGGGTGACCAAAAATCA |
|
| CAD | CD338F | F | ATGAARTAYGGYAATCGTGGHCAYAA |
|
| CAD | CD668R | R | ACGACTTCATAYTCNACYTCYTTCCA |
|
| CAD | CD688R | R | TGTATACCTAGAGGATCDACRTTYTCCATRTTRCA |
|
| AK | ForB2 | F | GAYTCCGGWATYGGWATCTAYGCTCC | Danforth, Lin, Fang 2005 |
| AK | RevB1 | R | TCNGTRAGRCCCATWCGTCTC | Danforth, Lin, Fang 2005 |
| AK | ForB4 | F | GAYCCCATCATCGARGACTACC |
|
Sequencing was performed on an Applied Biosystems 3730xl DNA Analyzer. Resulting chromatograms were loaded into Sequencher software v. 5.1 (Gene Codes Corporation, Ann Arbor, MI, USA) to manually edit, pair and export the resulting consensus gene sequences. Heterozygous sites in nuclear genes are coded with IUPAC ambiguity codes. This resulted in ~ 783bp arginine kinase (ArgK), and ~ 940bp carbamoyl-phosphate synthetase domain of rudimentary (CAD) for downstream use. These sequences have been submitted to GenBank under the accession numbers MW527463–MW527471 and MW527472–MW527489, respectively (Table S1).
There were several processing and quality checks performed on the gene data. Within Sequencher, chromatograms were assembled into contigs, and the primer regions were trimmed. Bases of low quality or that conflicted between forward and reverse reads were manually edited. After export from Sequencher, each gene was aligned using MAFFT v. 7 (
For MrBayes and RAxML-NG, the three gene concatenated dataset of 2350 sites was analyzed in Partitionfinder v2.1.1 (
The concatenated three gene dataset was analyzed using MrBayes v. 3.2.6 (
The three gene supermatrix was also run using maximum likelihood in RaxML-NG (
In addition, the following sequences were obtained from GenBank as the outgroups: Purpuricenus temminckii (Guérin-Méneville, 1844) [COI: LC484442.1 and MN905245.1; CAD: MN886365.1], Purpuricenus desfontainii (Fabricius, 1793) [COI: KM449194.1], Purpuricenus kaehleri (Linnaeus, 1758) [COI: KM286081.1], Purpuricenus sideriger Fairmaire, 1888 [COI: KF737809.1], Amarysius sanguinipennis (Blessig, 1872) [COI: MN905184.1; CAD: MN886315.1], Amarysius altajensis (Laxmann, 1770) [COI: KY683593.1 and MN905183.1; CAD: MN886314.1], Aromia moschata (Linnaeus, 1758) [COI: MH020478.1], and Aromia bungii Faldermann 1835 [COI: MN905189.1; CAD: MN886320.1], and respectively used in four separate phylogenetic analyses: (1) Bayesian and (2) maximum likelihood analysis of combined COI + CAD + ArgK data, (3) Bayesian analysis of CAD + ArgK data and (4) Bayesian analysis of COI data.
Analyses of the intra- and interspecific mitochondrial genetic distances were conducted in MEGA v. 7.0 software (
Two nearly sympatric Anoplistes populations were found in one extensive site (LK1) in the environs of the Choiriin Bogd Mountain [Чойрын Богд Уул] (46.24, 108.77), approx. 30 km SEE of Choir [Чойр] (“purple star” in Fig.
Field photographs of imagines in nature and the habitats of Anoplistes halodendri minutus. A, B: view on rocky habitat. C, D: the rock ecotype of A. h. minutus. E: view on sandy/gravelly habitat. F, G: the sand ecotype of A. h. minutus from the Choiriin Bogd Mountain. H: view on transition zone from sandy to rock habitat.
All of the individuals were found sitting on Caragana Fabr. (Fabaceae) shrubs. Although the pea-shrubs that grow in both plots of the above-described site appeared somewhat different in their structure, it was determined by local botanists that the pea-shrub individuals within the entire locality belong to the same species—Caragana leucophloea Pojark (Fig.
Field photographs of imagines in nature, host plants and habitats of Anoplistes halodendri minutus. A: Caragana leucophloea. B: Caragana bungee. C: C. leucophloea on rocky ground. D: C. leucophloea on sandy/gravelly ground. E, F: the sand ecotype of A. h. minutus from southern Mongolia. G, H: the desert habitats in southern Mongolia; (photos E–H by Badamnyambuu Iderzorig).
In order to confirm the relationship between the specific form and the type of environment, the habitus and habitat of the specimens from other regions of Mongolia (Figs
An interpretation of the ecological field data suggests the ecotypic, rather than a specific differentiation.
Over 500 specimens of Anoplistes halodendri minutus (Fig.
Habitus of some taxa of the Anoplistes halodendri species-group. A–M: Anoplistes halodendri minutus. A–F: rock ecotype; G–L: sand ecotype—Anoplistes kozlovi sensu
Results of the detailed morphometric measurements of 100 individuals of both forms revealed no statistically significant differences in the body length. Total body length in the males ranged from 7.6 to 11.4 mm (“minutus”, N = 30) vs 7.9 to 12.5 mm (“kozlovi”, N = 30); in the females, it ranged from 8.6 to 12.8 mm (“minutus”, N = 20) vs 8.0 to 12.0 mm (“kozlovi”, N = 20); 25–75% quartiles practically overlapped between the examined specimens of the two forms (Fig.
Comparative analysis of the pubescence density and length using SEM technology indicated that within both forms, densely pubescent and almost completely hairless individuals (considering the elytra and pronotum) occurred (Fig.
Clearly, the best trait for distinguishing both ecotypes is the shape and the range of the elytral spot, and, to a lesser extent, the colouration of their lighter part. The full range of the variability of these traits for both forms is presented (Fig.
An examination of the lateral lobes of the tegmen revealed no differences between the discussed ecotypes (Fig.
The shape of the median lobe (Fig. S2) appears to be a taxonomically uninformative character owing to its variability between taxa, being similar to the genus Ropalopus Mulsant, 1839 (Callidiini) of the same subfamily (
A detailed examination of the morphology of the specimens supported the ecological data in concluding that the two discussed entities seem to represent only ecologically adapted forms and therefore should not be treated as separate species.
Variability of the endophallic structures in the Anoplistes halodendri species-group. A–C: Anoplistes jacobsoni, with the terminology used in this paper. D–K: Anoplistes halodendri minutus. D–G: rock ecotype, two different specimens. H–K: sand ecotype—Anoplistes kozlovi sensu
The COI genetic distances that were calculated based on the sequences obtained from 15 individuals: seven A. halodendri minutus (both plots of the locality LK1) and eight A. kozlovi sensu
Summary of the intraspecific and mean interspecific genetic distances that were estimated using maximum composite likelihood model implemented in MEGA7. See Supplementary Table (S2) for the genetic distances between all of the specimens that were analysed. ‘n/a’ indicates a species in which only a single specimen was sequenced and therefore the intraspecific distance could not be calculated.
| Intraspecific distances [%] | Species | Mean interspecific distances [%] | ||||
| 1 | 2 | 3 | 4 | |||
| n/a | Anoplistes galusoi | 1 | ||||
| 0.18 | Anoplistes jacobsoni | 2 | 4.67 | |||
| 0.0–0.89 | Anoplistes kozlovi | 3 | 4.54 | 4.82 | ||
| 0.0–0.18 | Anoplistes halodendri minutus | 4 | 4.80 | 5.29 | 0.76 | |
| 0.00 | Anoplistes halodendri halodendri | 5 | 4.78 | 5.26 | 0.73 | 0.03 |
The intraspecific distances only varied from 0.0% to 0.18% in A. halodendri minutus and from 0.0% to 0.89% in A. kozlovi sensu
Afterwards, we barcoded two additional specimens of A. halodendri halodendri from northeastern Kazakhstan (very close to the type locality of the nominative subspecies). Interestingly, their COI sequences proved to be almost identical (0.0% for six and 0.18% for one specimen) with those of the rock ecotype of A. halodendri minutus from the Choiriin Bogd Mountain population, which exists nearly two thousand kilometers to the east and on the opposite side of the Altai Mountains. Although the barcoding data indicate no divergence and the habitus of the Kazakh specimens (Fig.
We also added two individuals of the morphologically close A. jacobsoni (S Kazakhstan) for additional comparison with this seemingly closely related taxon from outside Mongolia. The genetic distance between this species and A. halodendri minutus and A. kozlovi sensu
The dataset used for the phylogenetic reconstruction contained 627 bp of COI, 783 bp of ArgK and 940 bp of CAD, for a total of 2350 bp of nucleotide sequence. We considered Maximum likelihood bootstrap values (BS) 90–100% as very strong, 75–89% as strong, 50–74% as moderate and < 50% weak support, Bayesian posterior probability from MrBayes (PP) 100% as very strong, 90–99% as strong, 75–89% as moderate, and 50–74% as weak support.
Both the Bayesian (Fig.
Regarding the Anoplistes clade, the early-branching position of A. jacobsoni was emphasised. Inside the A. halodendri section of the trees node support was low and the two putative ecotypes were mixed.
Additional trees were run on the genetic datatypes as evolution can proceed at different pace. In the BI nuclear-only tree (Fig. S3), A. galusoi showed more disjunction, but the A. halodendri clade had no supported structuring. These genes normally distinguish species, and do that for A. galusoi, A. jacobsoni and the clade including putative ecotypes of A. halodendri. By analyzing the Bayesian COI tree (Fig. S4), Anoplistes halodendri was interestingly divided into two distinct clades that correspond to two putative ecotypes, except for a single individual from the desert region (LK0005). Additionally, the Anoplistes clade, although still revealed as monophyletic, received only moderate support (PP 87%) and showed a strong (PP 99%, thus practically very strong) association with Amarysius.
The results of the molecular analysis, which were fairly consistent with the ecological and morphological data, revealed generally very low genetic divergence between the two Mongolian entities in question, a situation where classification under a single taxon is standard. Therefore, we propose the synonymy Anoplistes halodendri minutus Hammarström, 1892 = Asias kozlovi Semenov and Znojko, 1934, as previously proposed by
It is common among the sedentary species that occur in isolated populations to exhibit a strong intraspecific genetic differentiation, which is driven either by geographical isolation or by a local ecological adaptation to specific environmental conditions. While the first factor has frequently been studied, the genetic effects from a local ecological adaptation are much less recognised (
0 Some form of preadaptation in order to develop a tolerance to a specific environmental variable exists in the normal population of a species. This provides the conditions that permit the evolution of an ecotype that is better adapted to the new conditions;
However, according to
It can be problematic to recognise and classify intraspecific forms and even more so to further distinguish possible ecotypes and subspecies, especially since both categories can occur within one species, as, for instance, is the case with the reindeer Rangifer tarandus (Linnaeus, 1758) (
A subspecies rank is commonly recommended to be used to recognise geographic distinctiveness. This term usually refers to one of two or more populations of a species that live in different regions of the species’ range and that differ from one another by a relatively weak morphological differentiation. The main criterion for recognising two distinct populations as subspecies, rather than as separate species, is their ability to interbreed without a fitness penalty. In natural conditions, subspecies do not interbreed due to their geographic isolation or sexual selection. A subspecific status should be considered when geographically separate populations of a species exhibit recognisable and predominantly stable phenotypic trait values. In other words, a subspecies is a recognised local variant of a species (
Conversely, an ecotype status is frequently assigned if a given form occurs throughout the geographic range of a species. Additionally, an ecotype is a variant in which the phenotypic differences are too few, too subtle or too unstable to warrant being classified as a subspecies. No taxonomic rank can be determined due to a lack of sterility barriers at this stage. Ecotypic variations can occur in the same geographic region where distinct types of habitats such as sand dunes and rocky slopes provide ecological niches. In the event that similar niches occur in widely separated places, similar ecotypic forms that are adapted to the effects of a very specific local environment can occur independently (
Thus, the main difference between these two terms is that a subspecies can exist across a number of different habitats and would usually be limited to a restricted part of a species’ range while ecotypes occur throughout the geographic range of a species in similar ecological niches.
As has been justified above, Anoplistes halodendri in Mongolia, northern China (Inner Mongolia) and southern Siberia has developed into two distinct ecotypes. Populations of sand and rock ecotypes of A. halodendri minutus are found throughout the geographic range of this taxon. The same pattern was documented in the case of lizards of the Eremias multiocellata—E. przewalskii species complex, which are also found in the region (
To conclude, the detailed morphological analysis, in particular regarding the endophallic structures, as well as the lack of clear patterns in the nuclear trees and relatively very low COI genetic distances (especially considering much higher genetic distances for morphologically and ecologically close A. jacobsoni) strongly indicate the cohesiveness of A. h. minutus including A. kozlovi and the need for synonymization.
It is worth mentioning that only one case of ecotypic variation has been documented in the family Cerambycidae to date. The yellow spotted longicorn beetle Psacothea hilaris (Pascoe, 1857) (Lamiinae: Lamiini) was divided into several subspecies, which are distributed mainly in Japan (
The beginnings of the differentiation of A. halodendri in the territory of today’s Mongolia most likely can be traced back to the period of the intensification of aridification in the region and the formation of the Gobi Desert ~ 24 to 2.6 Ma (
Given some of the rather stable differences in the phenotype of distant sand form populations, we consider it likely that similar ecotypes arose independently in different parts of the species’ range under parallel speciation. Individuals from the sand dunes in the northernmost part of the range differ from those from gravel desert in southern Mongolia and those from the Choiriin Bogd Mountain site in the steppe region (Fig.
The results of the COI analysis seem to confirm this scenario to a certain extent as the individuals of the rock ecotype from the Choiriin Bogd Mountain population turned out to be identical to the individuals of the very remote Kazakh population that share the same phenotype, while the individuals of the sand ecotype from two different regions in Mongolia, probably due to some assortative mating connecting populations in desertified habitats, were closer with each other (median, 0.18%) than with the neighboring population of the opposite ecotype (median, 0.71%). Still, however, when analysing the genetic distances more carefully, “minutus” revealed a closer relationship to the adjacent individuals of “kozlovi” (median, 0.71%) than to “kozlovi” from the southern populations (median, 0.89%).
Genetic data holistically supports the proposal that ecotypes can sympatrically form and develop a diagnosable morphology as a step towards reproductive isolation. The nuclear data show species level breaks in other taxa of Anoplistes yet there is no shared polymorphism in each of the putative ecotypes. The mitochondrial data, which evolve with a smaller effective population size than nuclear genes, indicate some isolation between ecotypes. A continuation of the observed population dynamics will be necessary for evolution beyond this incipient stage in the speciation process.
The differences in elytral colour pattern are probably correlated with the soil substrate. It seems opportunistic in more desertified habitats to develop lighter colored (pale orange) elytra with a narrow black stripe (most likely imitating the shadow of a peashrub stem). Colours in this pattern visibly better camouflage the beetle against the sand/gravel substrate and shrub structure, compared to almost entirely black elytra with two red spots, which in turn may work much better in spatially diversified rocky habitats with numerous objects that create varied shadows. Elytral and pronotal colouration resembling grass shadows on the ground is found in many species of the genus Eodorcadion (Cerambycidae: Lamiinae) that are widely distributed in this region. Most of the species have black elytra with a few wide stripes formed of white pubescence on each elytron. Such a contrasting colouration seems to be poor camouflage in desert and steppe habitats, however upon careful observation of these beetles, it becomes clear how effectively this pattern resembles shadows of Stipa grasses, especially in full sun.
It seems that the two discussed ecological forms of Anoplistes have not yet developed barriers to gene flow (reproductive isolation) as we observed a few mating couples in their contact zone. There are also no differences in endophallic structures, which makes us think that mating may be successful and not futile as is often the case between co-occurring anthophilous cerambycid species. Individuals from two adjacent habitats can meet and occasionally mate, however the total number of such mixed couples constitutes only a small percentage of the populations. Moreover, such a situation is only possible where these distinct habitats border each other, while the greater part of the species’ area is either flat sandy/gravelly plains or grassy steppes with rocky hills and the mountain regions. Furthermore, in addition to the above-mentioned fact that individuals of different ecotypes are less likely to mate, it seems reasonable that “alien” individuals die faster in the ecotone, and especially in the opposite habitat, as they are more easily spotted by predators, making these copulations even more sporadic and any offspring less fit. This is one of the basic mechanisms in parapatric speciation. In this mode, divergence may happen because of reduced gene flow within the population and varying selective pressures across the population’s range.
While Anoplistes was recovered as monophyletic in both the BI and ML analyses for all three genes combined with very strong or strong support (respectively), interestingly, Amarysius and Purpuricenus were rendered as paraphyletic. Although the representation of these genera (mainly for Purpuricenus as Amarysius includes only five species) might not be comprehensive enough to judge on divisions within this tribe, our results are consistent with those of the latest study in the subfamily Cerambycinae (
Within Purpuricenus, European P. kaehleri was placed (with very strong support) into one clade with the Asian genera Anoplistes and Amarysius as a sister group to the clade of the Asian Purpuricenus (P. sideriger and P. temminckii), which in turn is in the position of a sister group to European P. desfontainii. In the aforementioned study, Purpuricenus lituratus Ganglbauer, 1886 (not tested by us) revealed the paraphyly of the genus (
Surprisingly, A. jacobsoni revealed a strong divergence and long genetic separation from the morphologically very similar A. halodendri, though it was even considered to be a synonym of the latter by
L.Ka. concepted the work, wrote the main part of the manuscript, obtained SEM images, participated in field research, and managed DNA extraction; W.T.S. wrote some parts of the Material and methods section, performed the measurements, built the figures, and participated in field research; P.G. conducted lab analysis of two nuclear genes, performed the phylogenetic analyses, wrote portions of the paper, and improved the manuscript linguistically; L.Kr. prepared stacked images of the habitus, and participated in field research; D.G.K. prepared the endophallus section of the manuscript and the images of endophallic structures; all the authors meticulously reviewed the text.
This research was possible thanks to the support from the following grants of the first author: MINIATURA 2 Project (2018/02/X/NZ8/00235) from the National Science Centre, Poland and SYNTHESYS+ grant (HU-TAF-111), financed by the European Community Research Infrastructure Action under the H2020 Integrating Activities Programme. DNA barcoding was supported by Vasily Grebennikov (Canadian Food Inspection Agency, Canada). The authors thank the curators of the following institutions and private collectors for the loan of specimens: Ottó Merkl (
File 1
Data type: .pdf
Explanation note: File 1: KarpińskiEtAl-AnoplistesMG-Supplement — Fig. S1. Length ratios of antennomere 1 to the remaining antennomeres. — Fig. S2. Variability of the median lobes in the Anoplistes halodendri species-group. A–H, Anoplistes halodendri minutus; A–D, rock ecotype; E–H, sand ecotype – Anoplistes kozlovi sensu