Research Article
Print
Research Article
First insights into the phylogeny of the subgenus Cryobius Chaudoir, 1838 (Coleoptera: Carabidae: Pterostichus)
expand article infoJan Erik Sedlmeier, Arnaud Faille§
‡ University of Hohenheim, Stuttgart, Germany
§ State Museum of Natural History Stuttgart, Stuttgart, Germany
Open Access

Abstract

The past climatic changes caused repeated distribution shifts within insect populations leading to a highly diverse fauna in the mountain regions, which have acted as a refuge for many groups. There, some taxa have adapted to high altitudes and cold climatic conditions. One of those is the highly diverse and Holarctic subgenus Cryobius Chaudoir, 1838 (Carabidae: Pterostichus) including both locally and widely distributed species. Isolated and morphologically divergent populations of the same species led to the description of many subspecies. Until now, there has been no comprehensive work concerning the phylogeny of Cryobius, and genetic data on this taxon are sparse. This study is the first to provide insights into the molecular phylogeny of this subgenus, focusing on species from the Pyrenean and Cantabrian mountain systems. Cryobius specimens were sequenced targeting mitochondrial and nuclear genes. A molecular phylogeny was then built, merging the new data with genetic data from online public databases. All species of Cryobius included in this study form a monophyletic clade within Pterostichus. The synonymy of the two former taxa Pyreneorites and Haptoderus with Cryobius is confirmed by this study. Cryobius of the Pyreneo-Cantabrian area are closely related. Moreover, several well-supported clades of local species were found. The results further indicate a relation between Nearctic and Eastern Palearctic Cryobius, in agreement with the theory of faunal and floral colonization of North America via the Bering land bridge.

Keywords

Haptoderus, Pyrenees, Cantabria, ground beetle, orophily

1. Introduction

The phylogenetic classification of insects is a process that is subject to constant changes, not least due to the introduction of molecular methods, which lead to major progresses. And still, for most of the groups, an in-depth knowledge is missing (Wiegmann et al. 2009; Trautwein et al. 2012; Misof et al. 2014). This is especially the case among representatives of the highly diverse insect fauna of montane regions. It was found by various studies that species richness, not only of insects, is concentrated in mountains (Barthlott et al. 1996; Pryke and Samways 2010, Garrick 2011; Steinbauer et al. 2016; Polato et al. 2018). It is argued that repeated climatic fluctuations in the Pliocene and Pleistocene caused radical landscape changes leading to shifts in species distribution (Zinovyev 2007; Ehlers et al. 2018). During glacial maxima, populations retreated to isolated glacial refuges and adapted in situ, whereas some later recolonized the re-exposed areas. This repeated process driven by climatic fluctuations led to an acceleration of speciation in those regions, as postulated in the so-called ‘Pleistocene species pump’ hypothesis (Knowles 2000; Schoville et al. 2012; Wallis et al. 2016). Another contributing aspect are the different environmental conditions along altitudinal gradients (Körner 2007). Ultimately, all of those factors facilitate population isolation and specialization, and therefore contribute to explain the species richness in montane habitats.

Similar effects are observed in ground beetle fauna (Coleoptera: Carabidae). There are many diverse taxa comprising species that are adapted to high altitudes and cold climatic conditions. This is especially true for some representatives of the tribes Carabini, Pterostichini, Nebriini, or Trechini (Jeannel 1928; Müller-Motzfeld 2004). Additionally, many high altitude ground beetle species are brachypterous (atrophied hindwings) (Kavanaugh and Ball 1985). Flightlessness leads to a reduced dispersal rate, which is likely to further promote isolation. Considering all those facts, the study of the phylogeny of highly diverse montane ground beetle taxa is of great interest. Besides morphological characters and ecological information, genetic data is nowadays fundamental for our understanding of lineage diversification. Individual taxa of high altitude ground beetles have already been analyzed in molecular phylogenetic studies (see e.g. Schmidt 2011; Schmidt et al. 2012; Weng et al. 2016, 2020). Still, some taxa remain underrepresented in this regard, as is the case for some species of the Pterostichus subgenus Cryobius Chaudoir, 1838. This taxon was rearranged several times. The most important changes are summarized below.

Jeannel (1937) regarded Cryobius as a subgenus of Haptoderus Chaudoir, 1838. It was previously defined as a subgenus of Pterostichus Bonelli, 1810, but Jeannel regarded Haptoderus as a distinct genus. According to his views, Cryobius was a species-rich group distributed in the whole Arctic, North America, Asia and Europe, whereas Haptoderus was restricted to Europe and Central Asia (Jeannel 1937). In addition, Jeannel recognized that some Haptoderus species from the Pyrenees (e.g. pusillus (Dejean, 1828), infimus (Chaudoir, 1868), amoenus (Dejean, 1828)) differ in one morphological character (the punctuation of the metepisterna) from other species of Haptoderus and Cryobius. Therefore, he further divided the genus Haptoderus into three subgenera: 1. Haptoderus s.str., 2. Cryobius and 3. Pyreneorites Jeannel, 1937. Jeannel further stated that amongst those three subgenera, Pyreneorites and Cryobius would morphologically be very close to each other (Jeannel 1942). Interestingly, Pyreneorites exclusively included species that were described from the Pyrenees, but Haptoderus s.str. also comprised species restricted to the Pyrenees like abaxoides (Dejean, 1828), colasi (Jeannel, 1937) and amaroides (Dejean, 1828). Ball (1966) considered Pyreneorites as a synonym of Haptoderus and further proposed the subgeneric status of Haptoderus within Pterostichus. Finally, Bousquet (1999) synonymized Haptoderus with Cryobius. He chose to retain the name Cryobius, as the concept of this group includes both Palearctic and Nearctic species, in contrast to Haptoderus, which only includes Palearctic species (Bousquet 1999). The subgeneric status of Cryobius within the genus Pterostichus is nowadays consensual (Pupier 2011; Bousquet 2017).

As its name indicates (Greek: cryos = cold, bios = life), Cryobius comprises many cold-adapted species. About 215 species are currently described (subspecies not included) that are present in the Palearctic and the Nearctic (Bousquet 2012, 2017). They are most exclusively endemic to montane regions and often occur at high elevations. Many species described from the Pyrenees and the Cantabrian Range can be found above 2000 m (Jeannel 1942; Jeanne 1969). In contrast to that, P. pumilio (Dejean, 1828) is a widespread species found at low altitude, with records between ca 300 m and 1200 m in Germany for instance (Scheurig et al. 1996; Rietze 2001; Müller-Kroehling 2013; Borchard et al. 2014). As is often the case for ground beetles, the subgenus Cryobius includes both very widely and very locally distributed species. Amongst those, there are several Holarctic species. One remarkable example is P. brevicornis brevicornis (Kirby, 1837) which ranges from the Kola Peninsula (Northwest Russia) eastward to Newfoundland (Ball 1966; Zubrii et al. 2022). For the central European region, the species with probably the largest distribution range is P. unctulatus (Duftschmid, 1812). It is reported from 16 countries, ranging from the Alps to the Carpathians. Pterostichus pumilio pumilio is another example with a range expanding from the Cantabrian Mountains to the Carpathians (Jeannel 1942; Coulon and Pupier 2014; Bousquet 2017; Trautner 2017).

The size of Cryobius species roughly ranges between 4 and 12 mm (Jeannel 1937, 1942, 1947; Ball 1966). The coloration of the imagoes varies from brown to black. A reduction of wings is reported for many species. For example, Jeannel (1942) described the former subgenus Haptoderus as apterous. Bousquet (1999) states that in Cryobius the “wings are markedly reduced in all species”. More recent publications on Cryobius report only brachyptery (Ball and Currie 1997; Aßmann 1998; Strodl et al. 2007; Trautner 2017). In contrast to aptery, brachyptery merely describes the condition of atrophied hindwings that have no function as flight organs. It might be that Jeannel did not make this distinction when talking about Haptoderus species. Information on the wing formation is not available for all currently valid Cryobius species. However, it is likely that brachyptery is a common feature of this subgenus. In any case, there are no macropterous species described for this subgenus. Little is known about the biology and life cycles of Cryobius species. According to Bousquet (1999), in boreal forests specimens can be found under leaf litter and the bark of dead trees. Regarding the arctic and alpine tundra, they mainly live under rocks and in moss. Representative specimens of Cryobius from Western Europe are shown in Fig. 1.

Figure 1. 

Cryobius specimens. Left Pterostichus (Cryobius) colasi (Jeannel, 1937) male, from the Pyrenees. Right Pterostichus (Cryobius) pumilio (Dejean, 1828) female, from Cantabria. Scale bars: 3 mm.

Until now there has been no comprehensive work on the phylogeny of Cryobius. There are some publications discussing the relationships of several Pterostichus subgenera or relationships between the North American and European Cryobius. Still, all those works are mainly based on morphological characters (Jeannel 1937; Ball 1966). Molecular data on this subgenus are overall scarse. Some studies provide single mitochondrial or nuclear gene sequences of specimens that were included in general phylogenetic analyses of the genus Pterostichus or other subgenera than Cryobius (Will and Gill 2008; Sasakawa 2009; Raupach et al. 2010). Additional genetic material accessible was sequenced within data collection projects such as BOLD (www.barcodinglife.org).

The aim of this study is to provide a first insight into the molecular phylogeny of Cryobius by focusing on species inhabiting the Pyrenean and Cantabrian massifs, and to test the synonymy of the two subgenera Haptoderus and Pyreneorites. For that purpose, four gene fragments of several species were analyzed. A first molecular phylogeny was then built by combining these datasets with sequences publicly available at Genbank (www.ncbi.nlm.nih.gov/Genbank).

2. Methods

2.1. Taxon sampling

The specimens used for this work were mainly collected in the Pyrenean and Cantabrian mountain chains (Fig. 2). Further specimens included were from the Massif Central (France), Italy, Bosnia Herzegovina and Turkey. The respective collection sites are given in Table 2.

Figure 2. 

Sampling locations in the Pyrenees and the Cantabrian Range. Localities are labelled with the respective specimen codes. Google Maps layer edited with QGIS 3.16.6-Hannover (https://qgis.org/de/site/), edited with Adobe Illustrator v.26.0.3 (https://adobe.com/products/illustrator)

Directly after collection in field, the specimens were transferred to 2 ml plastic microtubes with sealed screw caps, filled with 95% ethanol to preserve the specimens. The tubes were later stored at –20° C. The specimens of each collection site were sorted by morphospecies. One individual of each morphospecies was used for DNA analysis. A code was then given to each of these specimens (e.g. ‘Cr2’, Table 2). These codes are referenced throughout this work. Spare specimens remained stored as described above. This procedure was carried out for all collection sites. In total, 26 specimens were sampled and processed for DNA analysis. The specimens are deposited at the Stuttgart State Museum of Natural History (SMNS).

2.2. DNA extraction, PCR amplification and sequencing

DNA extraction and purification were carried out with the DNeasy Blood & Tissue Kit (50) (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. The DNA extraction was non-destructive and processed with whole specimens. The areas between the head and the thorax and between the thorax and the abdomen were slightly opened to allow better digestion by the proteinase K. Overnight sample incubation for DNA extraction was performed with the Heating ThermoMixer MHL 23 (Ditabis, Pforzheim, Germany). Subsequently, the DNA concentration of each sample was measured using the NanoPhotometer® N60 (IMPLEN, München, Germany) to confirm a successful extraction.

Four gene fragments were targeted for sequencing including two mitochondrial and two nuclear genes: “cox1” cytochrome c oxidase subunit 1 – mitochondrial (CO1); “rrnl + tRNA-Leu + nad1” 5’ end of the large ribosomal 16S unit + tRNA-Leucine gene + 3’ end of the NADH dehydrogenase subunit 1 – mitochondrial (16S); “LSU” large ribosomal subunit – nuclear (28S); “SSU” small ribosomal subunit – nuclear (18S). The primers used are listed in Table 1. For some samples, the amplification of the whole fragment of CO1 and LSU fragments failed. In those cases, primer pairs targeting shorter but partially overlapping fragments were used. DNA amplification was carried out with the Taq PCR Master Mix Kit (250) (QIAGEN, Hilden, Germany) using the Labcycler Basic (SensoQuest, Göttingen, Germany). A standard program was first used for all PCRs. In case of an unsuccessful run (no–, insufficient– or ambiguous results shown in the control gel), the cycling programs were slightly altered to achieve better amplification results.

Table 1.

Primers used in this study.

Primer Name (Sense: forward F, reverse R) Sequence Reference
cox1 LCO 1490 (F) 5′GGTCAACAAATCATAAAGATATTGG3′ Folmer et al. (1994)
HCO 2198 (R) 5′TAAACTTCAGGGTGACCAAAAAATCA3′ Folmer et al. (1994)
K699 (F) 5′WGGGGGGTAAACTGTTCATCC3′ Wahlberg (2009)
RON (R) 5′GGAGCYCCWGATATAGCTTTCCC3′ Simon et al. (1994)
rrnl + tRNA-Leu + nad1 16Sar (F) 5′CGCCTGTTTAWCAAAAACAT3′ Simon et al. (1994)
ND1A (R) 5′GGTCCCTTACGAATTTGAATATATCCT3′ Simon et al. (1994)
LSU D1 (F) 5′GGGAGGAAAAGAAACTAAC3′ Ober (2002)
LS1R (R) 5′TTTCGGGTKTCWCAGGTTTAC3′ Kanda et al. (2014)
LS1F (F) 5′AGAGTTCAAGAGTACGTGAAACCG3′ Kanda et al. (2014)
D3L (R) 5′GCATAGTTCACCATCTTTCGGG3′ Kanda et al. (2014)
SSU 18S5’ (F) 5′GACAACCTGGTTGATCCTGCCAGT3′ Shull et al. (2001)
18Sb5.0 (R) 5′TAACCGCAACAACTTTAAT3′ Shull et al. (2001)

The PCR products were then controlled with a gel electrophoresis. Therefore a 1%-agarose gel (1:100 agarose / TAE buffer 1×) with GelRed® (Fremont, CA, USA) was run at 100 V in a Mupid® One Electrophoresis System, Advance (Mupid CO. LTD., Tokyo, Japan) for 25 min. The gels were then photographed under UV light using the Pentax TV Zoom lens 8–48 mm 1:1.0 (Ricoh Co. Ltd. Operations, Tokyo, Japan) and the BioDocAnalyze-Software (Analytik Jena GmbH, Jena, Germany). PCR product purification was conducted with the QIAquick PCR Purification Kit (250) (QIAGEN, Hilden, Germany). In preparation for sequencing, 5 µl of the purified PCR product and 5 µl of the respective primer were added to a 5 ml centrifuge tube. The same primer aliquots were used to reduce the possibility of contamination after the PCR product was controlled with a gel. The samples were then sent to the Macrogen laboratory Europe B.V. (Amsterdam, Netherlands) for sequencing.

The raw sequences were processed with GENEIOUS PRIME® 2020.2.2 (https://www.geneious.com). The sequences were cleaned and aligned with „Geneious Alignment“ (global alignment with free end gaps, cost matrix: 65% similarity) and primer sequences were trimmed using the „trim primer“ function. Consensus sequences were aligned with MUSCLE v.3.8.425 (R. C. Edgar, www.drive5.com/muscle/). Additional sequences of Pterostichus specimens available at Genbank (www.ncbi.nlm.nih.gov/Genbank) were added to the alignments. All specimens included in this work are listed in Table 2. The alignments were then exported to BIOEDIT v.7.2.5 (Hall 1999). Single sequences within the alignment were brought to the same length. Therefore, parts of the 5’ or 3’ ends of some sequences were cut or filled with a placeholder character which was then recognized as missing information by the following programs used in the phylogenetic analysis.

Table 2.

Sequenced specimens with localities, codes and GenBank accession numbers (new sequences in bold).

Subgenus (in ingroup) Genus (in outgroup) Species Locality Code CO1 28S 16S 18S Reference
Ingroup taxa
Cryobius Chaudoir, 1838 abaxoides cf. abaxoides (Dejean, 1828) Spain, Pyrenees, Huesca, Sierra Tendeñera, Biescas, 1983 m Cr22 ON969265 ON979805 this study
Cryobius Chaudoir, 1838 abaxoides cf. bigerricus (Jeannel, 1937) France, Pyrenees, Hautes-Pyrénées, Pic du Néouvielle, 2700 m Cr6 ON969266 ON979804 ON979788 this study
Cryobius Chaudoir, 1838 amoenus (Dejean, 1828) Spain, Pyrenees, Huesca, Sierra Tendeñera, Biescas, 2205 m Cr21 ON969283 ON979806 ON979822 this study
Cryobius Chaudoir, 1838 cf. anatolicus Jedlička, 1963 Turkey, Black Sea region, Trabzon, Hamsiköy, 1550 m Cr4 ON969268 ON979800 ON979816 this study
Cryobius Chaudoir, 1838 apenninus (Dejean, 1831) Italy, Apennine Alps, Piemont, Biella, Santuario di Oropa (beech grove) Cr2 ON969267 ON979798 ON979789 ON979823 this study
Cryobius Chaudoir, 1838 aralarensis aralarensis (Español & Mateu, 1945) Spain, Cantabrian Range, Basque region, Monte Gorbea, Dolina Cr26 ON969279 ON979808 ON979824 this study
Cryobius Chaudoir, 1838 aralarensis asturicus (Jeanne, 1969) Spain, Cantabrian Range, Cantabria, Puerto de la Magdalena, Luena Cr9 ON969284 ON979811 ON979786 this study
Cryobius Chaudoir, 1838 barryorum Ball, 1962 Canada, Nunavut, Bylot-Island HQ938140 iBOL – direct submission
Cryobius Chaudoir, 1838 brevicornis (Kirby, 1837) Canada, Nunavut, Cambridge Bay MN670020 Pentinsaari et al. 2020
Cryobius Chaudoir, 1838 cantabricus cantabricus (Schaufuss, 1862) Spain, Cantabrian Range, Asturias, Puerto de San Glorio Cr17 ON969278 this study
Cryobius Chaudoir, 1838 cantabricus cantabricus (Dejean, 1828) Spain, Cantabrian Range, Asturias, Puerto de San Glorio Cr25 ON969271 ON979810 ON979787 ON979821 this study
Cryobius Chaudoir, 1838 caribou Ball, 1962 Canada, Manitoba, Churchill KJ203835 Woodcock et al. 2013
Cryobius Chaudoir, 1838 colasi (Jeannel, 1937) Spain, Pyrenees, Lleida, Vielha, Panta de Senet, Barranco de Salenca Cr14 ON969264 ON979814 ON979818 this study
Cryobius Chaudoir, 1838 empetricola (Dejean, 1828) Canada, Yukon Territory, Whitehorse KR490739 Hebert et al. 2016
Cryobius Chaudoir, 1838 infimus (Chaudoir, 1868) Andorra, Pyrenees, Port d´Envalira, Pic Blanc Cr5.2 ON969280 ON979802 ON979790 ON979825 this study
Cryobius Chaudoir, 1838 kurosawai Tanaka, 1958 Japan, Hokkaido, Daseitsu mountains AB243485 Sasakawa 2009
Cryobius Chaudoir, 1838 nivalis (Sahlberg, 1844) USA, Alaska, St. Matthew Island KU876047 Sikes et al. 2016
Cryobius Chaudoir, 1838 pinguedineus (Eschscholtz, 1823) Canada, Manitoba, Churchill HQ582359 iBOL – direct submission
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) Germany, Rhineland-Palatinate, Zweibruecken-Mauschbach KM451184 Hendrich et al. 2014
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) Germany, Bavaria, Freyung-Grafenau KM444226 Hendrich et al. 2014
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) Germany, Thuringia, Fischbach/Rhoen KU915690 Rulik et al. 2017
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) France, Pyrenees, Ariège, Couflens, Cirque d´Anglade Cr1 ON969274 ON979813 ON979794 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) France, Pyrenees, Hautes-Pyrénées, Arrens-Marsous, Pic du Gabizos, 2000 m Cr3 ON969261 ON979809 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) France, Pyrenees, Pyrénées-Atlantiques, Sainte-Engrâce, in front of La Verna cave Cr8 ON969260 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) Spain, Pyrenees, Lleida, Vielha, Panta de Senet, Barranco de Salenca Cr13 ON969276 ON979795 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) France, Pyrenees, Pyrénées-Atlantiques, Gères Belesten Cr15 ON969277 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) France, Central Massiv, Cantal, Le Lioran, way to the Font de Cère pass Cr20 ON969281 ON979792 ON979820 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) Spain, Cantabrian Range, Asturias, Puerto de San Glorio Cr24 ON969262 ON979807 ON979793 this study
Cryobius Chaudoir, 1838 pumilio (Dejean, 1828) France, Central Massif, Cantal, Albepierre-Bredons, Prat de Bouc, 1279 m Cr27.2 ON969282 ON979815 this study
Cryobius Chaudoir, 1838 pusillus (Dejean, 1828) France, Pyrenees, Haute-Garonne, Oô, Portillon d’Oô, 2600 m Cr11 ON969263 ON979801 ON979791 ON979819 this study
Cryobius Chaudoir, 1838 pusillus pusillus (Dejean, 1828) France, Pyrenees, Hautes-Pyrénées, Pic du Néouvielle, 2700 m Cr7 ON969275 ON979803 this study
Cryobius Chaudoir, 1838 riparius (Dejean, 1828) Canada, British Columbia, Revelstoke JF888281 iBOL-direct submission
Cryobius Chaudoir, 1838 riparius (Dejean, 1828) USA, Montana, Flathead County EU142445 Will & Gill 2008
Cryobius Chaudoir, 1838 cf. subiasi (Ortuño & Zaballos, 1992) Spain, Cantabrian Range, Cantabria, Puerto de la Magdalena, Luena Cr9.2 ON969285 this study
Cryobius Chaudoir, 1838 cf. subiasi (Ortuño & Zaballos, 1992) Spain, Cantabrian Range, Cantabria, Bosque de Saja, Campoo de Cabuerniga Cr10 ON969270 ON979812 this study
Cryobius Chaudoir, 1838 subsinuatus (Dejean, 1828) Austria, Upper Austria, Salzkammergut KM441461 Hendrich et al. 2014
Cryobius Chaudoir, 1838 unctulatus (Duftschmid, 1812) Austria, Carinthia, Gurktaler Alps GU347340 Raupach et al. 2010
Outgroup taxa
Pterostichus Bonelli, 1810 brevis (Duftschmid, 1812) Bosnia Herzegovina, Igman, 1199 m Cr18 ON969269 ON979799 this study
Pterostichus Bonelli, 1810 burmeisteri Heer, 1837 Germany, Thuringia, Tambach-Dietharz KU917896 Rulik et al. 2017
Pterostichus Bonelli, 1810 lama (Ménétriés, 1843) USA, California, Sierra County EU142281 Will & Gill 2008
Pterostichus Bonelli, 1810 melanarius (Illiger, 1798) Germany, Schleswig-Holstein, Fehmarn GU347302 Raupach et al. 2010
Pterostichus Bonelli, 1810 niger (Schaller, 1783) Denmark, North Jutland, Skagens Gren MN122874 DNAmark project – direct submission
Pterostichus Bonelli, 1810 niger (Schaller, 1783) Schweden, Uppland KT204329 Staudacher et al. 2016
Pterostichus Bonelli, 1810 oblongopunctatus (Fabricius, 1787) Denmark, North Jutland, Byrum MN122833 DNAmark project – direct submission
Pterostichus Bonelli, 1810 oblongopunctatus (Fabricius, 1787) Germany, North Rhine-Westfalia, Haltern-Borkenberge GU347327 Raupach et al. 2010
Platyderus Stephens, 1828 magrinii Degiovanni, 2005 Italy, Tuscany, Arezzo, Eremo de Camaldoli Cr16 ON969273 ON979796 ON979817 this study
Platyderus Stephens, 1828 cf. pyrenaeus Tempère, 1947 Spain, Cantabrian Range, Navarre, Urbasa, Bidoiza Cr23 ON969272 ON979797 this study

2.3. Phylogenetic analysis

The cleaned alignments were exported in NEXUS format. For the combined analysis, the alignments were first assembled in a data matrix using SEQUENCE MATRIX v.1.8 (Vaidya et al. 2011). Tree reconstruction was performed by maximum likelihood analysis for all single genes as well as the combined matrix. W-IQ-TREE 1.6.12 (Trifinopoulos et al. 2016), available at the IQ-TREE web server http://iqtree.cibiv.univie.ac.at, was used for maximum likelihood analysis including ultrafast bootstrap (Hoang et al. 2017). The MODELFINDER tool was applied to determine the best fitting substitution model beforehand (Kalyaanamoorthy et al. 2017). The chosen models were TIM + F + I + G4 for CO1, TPM2u + F + I + G4 for 28S, TIM2 + F + I for 16S, JC for 18S and GTR + F + I + G4 for the combined alignment (Jukes and Cantor 1969; Kimura 1981; Tavaré 1986; Posada 2003). In addition, a Bayesian inference was performed for the combined matrix using MRBAYES 3.2.7a (Ronquist and Huelsenbeck 2003) applying the Markov chain Monte Carlo algorithm (MCMC) altered by Geyer (1991). The output was visualized with FIGTREE v.1.4.4 (http://github.com/rambaut/figtree/) and edited using Adobe Illustrator v.26.0.3 (https://adobe.com/products/illustrator). For the combined analysis, a chimera was created for P. riparius (Dejean, 1828) (JF888281 + EU142445). The determination of the respective specimens was trusted. Only the topology of the combined analysis is shown in the results section (Fig. 3). For the single gene analyses, a summary is given in Table 3.

Table 3.

Support for different clades according to the respective phylogenetic analysis. Single genes: results of maximum likelihood (ML), numbers indicate bootstrap value. “Combined”: result of ML analysis / result of Bayesian posterior probability. Note that less specimens were analyzed for 16S, 18S and 28S than for CO1. Abbreviations: excl. = excluding, subg. = subgenus.

Clade CO1 28S 16S 18S Combined
subg. Cryobius 100 x 78 x 100 / 100
Pyrenean Cryobius x x x x x / x
Pyrenean Cryobius excl. pumilio x x x x x / x
Cantabrian Cryobius x x x x x / x
Cantabrian Cryobius excl. pumilio 96 74 81 x 100 / 100
pumilio 94 x x n.a. x / x
pumilio + infimus x x 70 x 87 / 95
pumilio excl. Pyrenees/Cantabria 92 n.a. n.a. n.a. 99 / 100
Pyreneo-Cantabrian pumilio x 49 52 n.a. 61 / 88
subg. Haptoderus (Chaudoir, 1838) x x x x x / x
subg. Pyreneorites (Jeannel, 1937) x x x x x / x
Alpine Cryobius x n.a. n.a. n.a. x / x
Nearctic Cryobius x n.a. n.a. n.a. x / x
Legend:
bootstrap value > 80
bootstrap value 51 – 80
bootstrap value ≤ 50
x not recovered
n.a. not available (0 – 1 specimen tested)
Figure 3. 

Combined tree of CO1, 28S, 18S and 16S sequences based on maximum likelihood (ML) analysis. Numbers in nodes indicate ML bootstrap value / Bayesian posterior probability (both: only when >50). Coloration indicates species distribution patterns of Cryobius. “–” poorly supported node (value <50), “x” node not recovered by Bayesian analysis. P. = Pterostichus, C. = Cryobius, B. = Bothriopterus, Ch. = Cheporus, M. = Morphnosoma, Ph. = Parahaptoderus. In brackets: specimen code (CrXX, this study) or GenBank accession number. P. (C.) riparius: chimera (JF888281+EU142445). Specimen: Pterostichus pumilio, scale bar: 3 mm.

2.4. Morphological study

After DNA extraction the specimens were glued on rectangular cards for morphological study. For male individuals, the genitalia were removed beforehand and glued beside the specimen. Species determination was conducted regarding the currently valid species list of Cryobius published in the “Catalogue of Palearctic Coleoptera V1” (Bousquet 2017). The identification of the Pyrenean and Cantabrian species was mainly performed using the dichotomic key published in the “Faune de France Vol. 95” (Pupier 2011) and the “Faune de France Vol. 40” (Jeannel 1942) for male genital characteristics. The Turkish specimen was tentatively identified using species publications with type locality near the collection site, as there is no determination key available that includes all Palearctic Cryobius species. Additional information provided by the DNA analysis or distribution patterns of Cryobius species (Serrano 2013; Coulon and Pupier 2014; Bousquet 2017) was used to validate the morphological determination. When possible, determination was carried out to subspecies level. However, in some cases, the variability of external characters even within populations (Pupier 2011) or missing information concerning characters of female genitalia did not allow for an unambiguous classification at the subspecies level.

Species identification of non-Cryobius specimens was conducted with the “Käfer Mitteleuropas – Band 2, Adephaga 1” (Müller-Motzfeld 2004).

3. Results

3.1. The subgenus Cryobius is recovered as a monophyletic group within Pterostichus

Our data support the monophyly of Cryobius with a bootstrap value (BV) of 100 and a Bayesian probability of 100 (BP) in the combined tree (Fig. 3). This monophyly is also recovered by the CO1 and the 16S single gene analyses (BV = 100 and 78, respectively; Table 3). The two conserved markers 28S and 18S do not show a distinct Cryobius clade. However, it must be said that testing the monophyly of Cryobius was not the scope of this work and the type species of Cryobius (C. ventricosus (Dejean, 1831)) was not included, although two species belonging to the ventricosus group sensu Ball (1966) (C. caribou Ball, C. riparius Dejean) were included. Also, a much more comprehensive sampling of Pterostichus subgenera and species would be required to achieve this aim.

No support was found for the synonymized subgenera Haptoderus and Pyreneorites. Neither the combined – nor the single gene phylogenies showed a distinct clade for either Haptoderus – or Pyreneorites species (Fig. 4, Table 3).

Figure 4. 

Phylogenetic position of the former subgenera Haptoderus (blue) and Pyreneorites (red), excerpt of the tree from combined analysis (Fig. 3) of CO1, 28S, 18S and 16S sequences based on maximum likelihood (ML) analysis. Numbers in nodes indicate ML bootstrap value / Bayesian posterior probability (only when >50), “x” node not recovered by Bayesian analysis. P. = Pterostichus, C. = Cryobius, M. = Morphnosoma, Ph. = Parahaptoderus. In brackets: specimen code (CrXX, this study) or GenBank accession number. P. (C.) riparius: chimera (JF888281 + EU142445).

3.2. The Pyreneo-Cantabrian Cryobius

The Pyrenean and Cantabrian specimens form a monophyletic clade together with P. pumilio. The local Pyrenean species P. infimus is, regarding the combined phylogeny, grouped in one clade with P. pumilio (BV = 87, BP = 95). This arrangement is also found by 16S (BV = 70) and 18S, but here with low support. In the CO1 analysis, P. infimus is placed as sister to P. pumilio (BV = 79), which is not the case in the 28S phylogeny. According to the combined phylogeny, the remaining species with an exclusively Pyrenean or Cantabrian distribution are grouped in three separate clades.

3.3. P. pumilio

The widely distributed species P. pumilio does not, according to the combined tree, form a monophyletic group since the Pyrenean P. infimus belongs to the clade. A monophyly for P. pumilio is only recovered in the CO1 topology (BV = 94). The clade of Pterostichus pumilio is further divided into two subclades. The first is a clade of specimens from the Massif Central (Cr20 + Cr27.2) and Germany (BV = 99) and BP = 100 in the combined tree). The clade is also recovered and well supported within the CO1 tree (BV = 92) (Table 3: “pumilio excl. Pyrenees/Cantabria”). No statement concerning the support for this clade is possible for the three other markers taken independently (16S, 28S, and 18S) as for those gene fragments only one sequence was available for this group. The second clade comprises Pyrenean and Cantabrian P. pumilio with a BV of 61 and a BP of 88 in the combined tree (Table 3: “Pyreneo-Cantabrian pumilio”). It has low support in the 28S and 16S trees (not tested in 18S). The clade was not recovered in the CO1 phylogeny.

3.4. The P. abaxoides- and pusillus groups

Except for P. infimus, all Cryobius specimens with an exclusive Pyrenean distribution are arranged in two sister clades. The clade containing P. abaxoides and P. colasi is very well supported (BV = 97, BP = 100). The adjacent clade contains P. pusillus and P. amoenus with a relatively good support (BV = 75, BP = 82). Within those Pyrenean Cryobius, two subclades are well supported: one gathering all specimens of P. abaxoides (BV = 100, BP = 100) and one including all specimens of P. pusillus (BV = 100, BP = 100). Both are based on two specimens each.

3.5. The P. cantabricus group

Another well supported clade includes the P. cantabricus – and P. aralarensis groups (BV = 100, BP = 100), as well as two P. cf. subiasi (Ortuño et Zaballos, 1992) specimens (further discussed below). This clade will be referred to as the ‘Cantabrian clade’ (Table 3: “Cantabrian Cryobius ex pumilio”; including all Cantabrian specimens, P. pumilio excluded). The Cantabrian clade is also found in the CO1 tree (BV = 96), the 28S tree (BV = 74) and the 16S tree (BV = 81). It is not recovered in the 18S single phylogeny.

Two Spanish specimens (Cr9.2: female, Cr10: male) included in the Cantabrian clade were determined as P. (C.) cf. subiasi. Based on their outer morphology and their position within the tree, it was assumed that they are the same species. The uncertainty of the determination at species level was due to several ambiguous clues. The morphology of the aedeagus of specimen Cr10 resembles that of P. subiasi. When compared to all Spanish Cryobius, the external morphological characters of Cr9.2 and Cr10 are also most consistent with the ones described for P. subiasi. However, some do not match, such as the body length, the size of the eyes, characters of the pronotum and the elytra (Table 4). Additionally, the collection sites of these two specimens are not matching the currently known distribution of P. subiasi. Morphology suggests both limited relatedness to P. subiasi and to P. cantabricus.

Table 4.

Differences in the external morphology of Pterostichus subasi and the specimens Cr9.2 and Cr10. Characters of P. subiasi are taken from Ortuño and Zaballos (1992). Abbreviations: incl. = including, post. = posterior.

Character state P. subiasi (Ortuño and Zaballos, 1992) Character state Cr9.2 / Cr10
Body length 6.3 – 6.8 mm 7.5 mm (Cr10), 8 mm (Cr9.2)
Head eyes only slightly prominent eyes prominent
Pronotum front angles little pronounced front angles pronounced and protruded
posterior margin almost straight, slightly arched between hind angles posterior margin straight towards the hind angles but concave in the middle
Elytra (each) 9th interval wider than the others 9th interval not wider than the others
a seta near origin of 2nd stria no seta near origin of 2nd stria

3.6. Cryobius from the Alps

The species from the Alps – P. apenninus (Dejean, 1831) (Apennine Alps), P. subsinuatus (Dejean, 1828) and P. unctulatus (Austrian Alps) – do not form a clade in the combined– or the CO1 phylogeny (Table 3: “Alpine Cryobius”).

3.7. The Nearctic and Eastern Oriental Cryobius

The sequences for the Nearctic Cryobius species were obtained from Genbank, most are CO1 except for one sequence of 28S for one specimen (P. riparius). A clade with all those species together was never recovered, neither in the combined tree, nor in the CO1-only tree. According to the combined phylogeny, the Nearctic species are divided into two separate but well supported groups, respectively, which are intermixed with Palearctic species.

One group includes two Canadian species (P. brevicornis + P. empetricola) and one from Alaska (P. nivalis). Within that group, the two Canadian species form a well-supported clade (BV = 100, BP = 100). The other Nearctic species are grouped with the Japanese P. kurosawai Tanaka, 1958 which is closest to P. riparius (BV = 79, not recovered in the Bayesian inference). The relative position of these groups differs in the CO1 phylogeny, but the supports are lower.

3.8. P. cf. anatolicus

Pterostichus (Cryobius) cf. anatolicus Jedlička, 1963 from Northeast Turkey is placed at the base of Cryobius as a sister to all other species, but without support. In addition to the combined phylogeny, this basal position of P. cf. anatolicus is also recovered by the analyses of CO1 and 28S only. However, in all cases this position is not well supported. 16S and 18S were not sequenced for this specimen.

4. Discussion

4.1. The subgenus Cryobius

This study is the first to provide phylogenetic data on the Pterostichus subgenus Cryobius. However, Cryobius was not tested for monophyly, but first molecular support for a monophyly of Cryobius is provided. Subsequent studies with a more comprehensive sampling of the genus Pterostichus are needed to further address this issue. Such subsequent studies would be important to verify the current phylogenetic status of Cryobius which is based on morphological clues (Ball 1966).

4.2. Haptoderus and Pyreneorites

Within the phylogeny of Cryobius, no distinct clades of the former Haptoderus s.str. or Pyreneorites were recovered. Although not all species originally assigned to these two taxa were included in this study, the type species for Haptoderus (P. pumilio) and Pyreneorites (P. pusillus) were included.

In his revision of the genus Haptoderus, Jeannel (1937) distinguished the subgenera Haptoderus s.str. and Pyreneorites by the punctuation of the metepisterna, lacking in Pyreneorites, a character not mentioned by Ball (1966). Regarding the specimens of this study (Fig. 4), this character was reliable except for P. pumilio, for which the punctuation was sparse or absent in many specimens. Only the individual Cr27 showed a clear punctuation. Considering that this character is not mentioned in current determination keys, it could be that the punctuation of the metepisterna is a varying and hence unreliable character within Cryobius. Furthermore, Jeannel (1937) only used morphological clues for his separation of the former three subgenera. This led to the fact that the species of Pyreneorites were not the only ones exclusively distributed in the Pyrenees, as several species of Haptoderus s.str. were, according to Jeannel, also restricted to the Pyrenees (Jeannel 1937). In light of this, the synonymy of Pyreneorites with Haptoderus by Ball (1966) appears reasonable.

Ultimately, the synonymy of Haptoderus and Cryobius by Bousquet (1999) is also supported by the molecular data obtained in this study, as the specimens of Haptoderus (incl. Pyreneorites) and Cryobius form a monophyletic group.

4.3. The Pyreneo-Cantabrian Cryobius

The focus of this study was on the Pyrenean and Cantabrian Cryobius species. The results show that there are three lineages in the Pyreneo-Cantabrian mountain massifs, (i) one made up by P. (C.) pumilio-infimus, (ii) one by members of the P. (C.) cantabricus group and (iii) that formed by species of the P. (C.) abaxoides-amoenus group. The addition of molecular data from other taxa inhabiting either the Pyrenees (e.g. P. (C.) amaroides (Dejean, 1828), P. (C.) amblypterus (Chaudoir 1868)) or the Cantabrian Mountains (P. (C.) ehlersi (Heyden, 1881)) may even show the existence of new lineages. It is expected that a complete taxon sampling will show the existence of a large monophyletic clade comprising all taxa from the Pyrenees and the Cantabrian Mountains, including the widely distributed species P. (C.) pumilio, which likely became secondarily adapted to montane and lowland forests of central Europe. Within this large clade, others are expected to be found including (i) taxa restricted to the Pyrenees or the Cantabrian Mountains, or (ii) others occupying both mountain systems as is the case of the P. (C.) cantabricus clade. This hypothesis agrees with that formulated by Ortuño and Zaballos (1992) about a progressive colonization of the north Iberian mountains by ancestral Cryobius coming from the Pyrenees, perhaps from the onset of the Pleistocene.

4.4. The Pyrenean Cryobius

In the combined tree, the Pyrenean species P. infimus is grouped with the widely distributed P. pumilio. This arrangement is not recovered in the CO1, 28S and 18S single gene analyses. At species level, P. infimus is morphologically well characterized. Therefore, a false determination of the specimen is unlikely. Pterostichus infimus might be the sister species of P. pumilio. This would have to be investigated further by adding more genetic data of other specimens and species. Pterostichus infimus comprises three subspecies with unreliable morphological characters (Pupier 2011; Bousquet 2017). Hence, a genetic analysis of those populations could help to clarify the status.

The other Pyrenean Cryobius form two sister clades. Within those, the clades of P. abaxoides and P. pusillus, each represented by two specimens, are well supported. For both species and most Pyrenean taxa, several subspecies have been described, as expected for alpine beetle populations with low dispersal power and reduced gene flow. The use of barcoding might help to assign specimens to described subspecies or to test the validity of these subspecies. Additionally, a broader sampling is necessary – including the type localities of all the described taxa – to precise the distribution of those populations. A question to answer would be if those subspecies form isolated populations across the Pyrenees or whether there is genetic exchange, in which case they are probably not valid and should be synonymized.

4.5. The Cantabrian clade

The Cantabrian species form a supported clade in which the position of the two P. aralarensis subspecies is unexpected as they are placed separately. The genetic differentiation between these two subspecies could be explained by the large geographic distance between the sampling locations. One corresponds to the occidental Pyrenees (P. (C.) a. aralarensis)), the other to the Cantabrian Massif (P. (C.) a. asturicus)), respectively. In this case, it seems that the morphological differentiation has occurred at a slower rate than the molecular one. This hypothesis deserves further in-depth investigation.

According to Pupier (2011), Jeanne reported P. aralarensis from the Pic d’Anie (Eastern Pyrenees) being far East from its Eastern distribution border in Spain (Aralar Range). However, this record is dubious (Coulon and Pupier 2014, Serrano pers. com.)

The two P. cf. subiasi specimens (Cr9.2 and Cr10), share several ambiguous clues compared to what is known about this species. Regarding the morphological characters, the larger size of the specimens, the form of the fore angles of the pronotum, and the lack of setae at the base of the second elytral stria in both specimens are the most noticeable. Also, the collection sites of the two specimens are about 200 km apart from the two only known distribution areas of P. subiasi in Northwest Spain: the Sierra de Los Ancares (Lugo) and the Sierra del lnvernadero (Orense) (Serrano 2013). However, this species was described relatively recently (1992) compared to other Cryobius species. It is therefore likely that the current information about the distribution of P. subiasi is incomplete due to a lack of sampling. Still, the morphological ambiguity does not allow a clear assignment of Cr9.2 and Cr10 to P. subiasi. It could be that these specimens belong to an undescribed species possibly close to P. subiasi. To clarify this, more sampling in the respective distribution areas and, most importantly, more genetic information would be needed.

4.6. The case of the widespread species P. pumilio

Pterostichus pumilio comprises two subspecies: P. pumilio pumilio and P. pumilio nevadensis (Jeannel, 1947). However, P. pumilio nevadensis is not considered in this study, as it is only described from the Sierra Nevada in southern Spain, a record which was questioned by Serrano (2013).

A monophyletic clade for P. pumilio was only recovered in the CO1 tree, but with low support. This is due to the close relation with the P. infimus specimen that is discussed in paragraph 4.3. above. Still, two groups of P. pumilio are recovered in the phylogeny: “pumilio excl. Pyrenees/Cantabria” and the “Pyreneo-Cantabrian pumilio”. Interestingly, Jeannel (1949) discussed the presence of two forms for P. pumilio. First, the Central European form, which was described as spadiceus (Dejean, 1828). This form is distributed at lower altitudes in France but can be found above 1500 m in the Alps and the Massif Central. Second, the pumilio s.str. form which is typical for the Pyrenees (no mention of the Cantabrian Range) where it reaches very high altitudes. It is characterized by a minor size and differences in the shape of the pronotum and elytral striae. Given the collection localities, the two P. pumilio groups shown by the combined tree could reflect those two population groups. However, a morphological analysis of the nine P. pumilio specimens collected for this study could not confirm most of the characters described for pumilio and spadiceus. The absence of the parascutellar stria in the pumilio s.str. form could be confirmed for the Pyrenean specimens whereas the specimens from the Massif Central (Cr.20 and Cr27.2) showed slight remains of this stria, as described for the spadiceus form. However this finding must be viewed with caution since Español and Mateu (1945) generally considered the parascutellar stria a non-reliable character.

The altitude of the collection localities between the two groups did not differ significantly. More sampling and sequencing of those two groups is needed to further investigate Jeannel’s hypothesis of two P. pumilio forms. The fact that the Cantabrian specimen Cr24 of P. (C.) pumilio is closely related to Pyrenean ones (Fig. 3) confirms that this species is an exception within Cryobius of these mountains, due to its dispersal and colonization abilities denoted by its wide distribution area. It should be noted that Cr24 also lacked the parascutellar stria, as found in Pyrenean specimens.

4.7. The Eastern Cryobius

The position of three species with an Alpine to Eastern European distribution (P. apenninus, P. subsinuatus and P. unctulatus) in the phylogeny does not allow statements concerning the lineage, as the supports are low and the sampling is scarce. Though, the lack of molecular data on species from the Alps and other European mountain systems is a major limitation to investigate whether the Cantabrian Range and the Pyrenees were colonized via the Alps or vice versa.

4.8. The Nearctic Cryobius

The Nearctic Cryobius species did not form a monophyletic group but were intermixed with Palearctic species. The reason for this could be that these specimens were only based on CO1, except for the P. riparius chimera combining a CO1– and a 28S sequence (Table 3). It can be expected that an inclusion of more taxa, and genes with different levels of conservation, would change the arrangement of the Nearctic Cryobius. Yet, most of the publicly available sequences for Nearctic Cryobius are currently from CO1.

An interesting result is the grouping of two Nearctic species with the Japanese P. kurosawai (Hokkaido). Unfortunately, this specimen was represented by a 28S fragment only. In the combined tree, as well as in the 28S tree, it is closest to the North American P. riparius, a species that, according to Bousquet (2012), “ranges from central Alaska to eastern Alberta” (Canada). According to Morita (2002), P. kurosawai is reported from Western Russia (Primorskij Territory, Sakhalin Island) and Northern Japan (Hokkaido, Rishiri Island). This relation between Palearctic and Nearctic Cryobius is in line with several studies showing a disjunct distribution of Eastern Asian and Northern American flora and fauna (Kruckeberg 1983; Ball and Currie 1997; Zhou et al. 2012; Weng et al. 2016; Liu et al. 2017; Haas et al. 2020; Sugawara et al. 2021). This biogeographical pattern is often explained by migration events across the Bering land bridge between the Cretaceous and the Quaternary (Sanmartín et al. 2001). In fact, in his revision of Cryobius, Ball (1966) stated that the subgenus Cryobius would have no close relatives in North America but was morphologically similar to several Palearctic subgenera of Pterostichus. Therefore, he assumed that the North American Cryobius would have a Palearctic origin. Ball and Currie (1997) listed Cryobius species according to their geographic distribution assigning several species as either Beringian, Palearctic-Beringian or Nearctic-Beringian. Here, in contrast to Bousquet (2012), P. riparius is listed as a Palearctic-Beringian species.

5. Conclusion

This study provides a first insight into the molecular phylogeny of the subgenus Cryobius. A monophyletic origin of this taxon is suggested. The combined phylogeny also supports the current taxonomic state of Cryobius as a subgenus of Pterostichus. The investigation of the Pyrenean and Cantabrian Cryobius did not reveal separated groups in general. Instead, shared lineages between both massifs might suggest that there could be a monophyletic clade comprising all taxa from the Pyrenees and the Cantabrian mountains, including widespread species as P. pumilio. The relationship between pumilio and eastern species remains to be tested. Although our sample of Pterostichus subgenera was limited, Cryobius sensu Ball and Bousquet is corroborated by our molecular data and that is well differentiated from similar lineages of the vast genus Pterostichus. Open questions concerning the origin of lineages, colonization routes, distribution patterns, and the validity of subspecies demand further investigation. This might also allow to test the impact of glaciations in the diversification of the group (Schoville et al. 2012). In this regard, the alpine Cryobius certainly represent a good model to study the impact of glacier retreat on high altitude biodiversity (Sommer et al. 2020).

6. Acknowledgements

We want to thank the following colleagues who contributed for the field part of this project: Charles Bourdeau, David H. Kavanaugh, Ignacio Ribera, Javier Fresneda, Pau Balart-García and Pier Mauro Giachino. A special thanks goes to Sonja Dumendiak (SMNS) who accompanied the laboratory work and to Aron Bellersheim (SMNS) for assisting the photography, and to J. Serrano and the two reviewers for constructive comments on a early version of the manuscript.

7. References

  • Aßmann T (1998) A new subspecies of Haptoderus (Iberoderus) cantabricus Schaufuss 1862 (Coleoptera, Carabidae, Pterostichini). Acta Coleopterologica 14: 47–50.
  • Ball GE (1966) A revision of the North American species of the subgenus Cryobius Chaudoir (Pterostichus, Carabidae, Coleoptera). Opusca Entomologica, Lund, Supplementum 28: 1–166.
  • Ball GE, Currie DC (1997) Ground beetles (Coleoptera: Trachypachidae and Carabidae) of the Yukon: geographical distribution, ecological aspects, and origin of the extant fauna. Insects of the Yukon. Biological Survey of Canada (Terrestrial Arthropods), Ottawa: 445–489.
  • Barthlott W, Lauer W, Placke A (1996) Global Distribution of Species Diversity in Vascular Plants: Towards a World Map of Phytodiversity (Globale Verteilung der Artenvielfalt Höherer Pflanzen: Vorarbeiten zu einer Weltkarte der Phytodiversität). Erdkunde 50: 317–327.
  • Borchard F, Buchholz S, Helbing F, Fartmann T (2014) Carabid beetles and spiders as bioindicators for the evaluation of montane heathland restoration on former spruce forests. Biological Conservation 178: 185–192. https://doi.org/10.1016/j.biocon.2014.08.006
  • Bousquet Y (1999) Supraspecific classification of the nearctic Pterostichini (Coleoptera: Carabidae). Fabreries, Supplément 9: 1–292.
  • Bousquet Y (2017) Tribe Pterostichini Bonelli, 1810. In: Löbl I, Löbl D (Eds) Catalogue of Palearctic Coleoptera: Archostemata-Myxophaga-Adephaga. BRILL, 704–711.
  • Coulon J, Pupier R (2014) Harpalidae. In: Tronquet M (Ed.) Catalogue des Coléoptères de France. Association Roussillonnaise d’Entomologie, Perpignan, France, 156–157.
  • Español CF, Mateu SJ (1945) Coleópteros nuevos de la Sierra del Aralar (confines Navarra-Guipúzcoa). EOS, Revista Española de Entomología 21: 259–273.
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Garrick RC (2011) Montane refuges and topographic complexity generate and maintain invertebrate biodiversity: recurring themes across space and time. Journal of Insect Conservation 15: 469–478. https://doi.org/10.1007/s10841-010-9349-4
  • Geyer CJ (1991) Markov chain Monte Carlo maximum likelihood. In: Keramidas EM (Ed.) Computing Science and Statistics: Proceedings of the 23rd Symposium on the Interface. Fairfax Station: Interface Foundation of North America. 156–163.
  • Gobbi M. (2020) . Global warning: challenges, threats and opportunities for ground beetles (Coleoptera: Carabidae) in high altitude habitats. Acta Zoologica Academiae Scientiarum Hungaricae, 66 (Suppl.), 5–20. https://doi.org/10.17109/AZH.66.Suppl.5.2020
  • Haas GMS, Hoberg EP, Cook JA, Henttonen H, Makarikov AA, Gallagher SR, Dokuchaev NE, Galbreath KE (2020) Taxon pulse dynamics, episodic dispersal and host colonization across Beringia drive diversification of a Holarctic tapeworm assemblage. Journal of Biogeography 47: 2457–2471. https://doi.org/10.1111/jbi.13949
  • Hall TA (1999) BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Hebert PDN, Ratnasingham S, Zakharov EV, Telfer AC, Levesque-Beaudin V, Milton MA, Pedersen S, Jannetta P, deWaard JR (2016) Counting animal species with DNA barcodes: Canadian insects. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 371: 20150333. https://doi.org/10.1098/rstb.2015.0333
  • Hendrich L, Morinière J, Haszprunar G, Hebert PDN, Hausmann A, Köhler F, Balke M (2015) A comprehensive DNA barcode database for Central European beetles with a focus on Germany: adding more than 3500 identified species to BOLD. Molecular Ecology Resources 15: 795–818. https://doi.org/10.1111/1755-0998.12354
  • Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS (2017) UFBoot2: Improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Jeanne C (1969) Les Haptoderus lusitaniens (Coleoptera, Pterostichidae). Miscelánea Zoológica 2: 33–38.
  • Jeannel R (1928) Monographie des Trechinae. Morphologie comparée et distribution géographique d’un groupe de Coléoptères (Troisième livraison). Les Trechini cavernicoles. Abeille, Paris 35: 1–808.
  • Jeannel R (1937) Révision du Genre Haptoderus Chaudoir. Revue Française d’Entomologie 4: 9–23.
  • Jeannel R (1942) Coléoptères Carabiques. Deuxième partie. Faune de France 40. Librairie de la Faculté des Sciences, Paris: 573–1173.
  • Jeannel R (1947) Sur les Haptoderus des Pyrénées (Coleoptera, Pterostichidae). Revue Française d’Entomologie 14: 105–118.
  • Jeannel R (1949) 51 Coléoptères Carabiques Supplément. Fédération Française des Sociétés de Sciences Naturelles: Office Central de Faunistique, 50 pp, 20 plates.
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haesler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589.
  • Kanda K, Pflug JM, Sproul JS, Dasenko MA, Maddison DR (2015) Successful recovery of nuclear protein-coding genes from small insects in museums using Illumina Sequencing. PLOS ONE 10: e0143929. https://doi.org/10.1371/journal.pone.0143929
  • Kavanaugh DH (1985) On wing atrophy in carabid beetles (Coleoptera: Carabidae), with special reference to Nearctic Nebria. In: Ball GE (Ed.) Taxonomy, Phylogeny and Zoogeography of Beetles and Ants. Dr. W. Junks Publishers, Dordrecht, Netherlands, 408–431.
  • Kimura M (1981) Estimation of evolutionary distances between homologous nucleotide sequences. Proceedings of the National Academy of Sciences of the United States of America 78: 454–458. https://doi.org/10.1073/pnas.78.1.454
  • Kruckeberg AR (1983) Temperate floras: The North Pacific Connection. Annals of the Missouri Botanical Garden 70: 591–596. https://doi.org/10.2307/2398978
  • Liu P, Wen J, Yi T (2017) Evolution of biogeographic disjunction between eastern Asia and North America in Chamaecyparis: Insights from ecological niche models. Plant Diversity 39: 111–116. https://doi.org/10.1016/j.pld.2017.04.001
  • Misof B, Liu S, Meusemann K, Peters RS, Donath A, Mayer C, Frandsen PB, Ware J, Flouri T, Beutel RG, Niehuis O, Petersen M, Izquierdo-Carrasco F, Wappler T, Rust J, Aberer AJ, Aspöck U, Aspöck H, Bartel D, Blanke A, Berger S, Böhm A, Buckley TR, Calcott B, Chen J, Friedrich F, Fukui M, Fujita M, Greve C, Grobe P, Gu S, Huang Y, Jermiin LS, Kawahara AY, Krogmann L, Kubiak M, Lanfear R, Letsch H, Li Y, Li Z, Li J, Lu H, Machida R, Mashimo Y, Kapli P, McKenna DD, Meng G, Nakagaki Y, Navarrete-Heredia JL, Ott M, Ou Y, Pass G, Podsiadlowski L, Pohl H, von Reumont BM, Schütte K, Sekiya K, Shimizu S, Slipinski A, Stamatakis A, Song W, Su X, Szucsich NU, Tan M, Tan X, Tang M, Tang J, Timelthaler G, Tomizuka S, Trautwein M, Tong X, Uchifune T, Walzl MG, Wiegmann BM, Wilbrandt J, Wipfler B, Wong TKF, Wu Q, Wu G, Xie Y, Yang S, Yang Q, Yeates DK, Yoshizawa K, Zhang Q, Zhang R, Zhang W, Zhang Y, Zhao J, Zhou C, Zhou L, Ziesmann T, Zou S, Li Y, Xu X, Zhang Y, Yang H, Wang J, Wang J, Kjer KM, Zhou X (2014) Phylogenomics resolves the timing and pattern of insect evolution. Science 346: 763–767. https://doi.org/10.1126/science.1257570
  • Moret P, de los Aráuz MÁ, Gobbi M, Barragán Á (2016) Climate warming effects in the tropical Andes: first evidence for upslope shifts of Carabidae (Coleoptera) in Ecuador. Insect Conservation and Diversity 9: 342–350. https://doi.org/10.1111/icad.12173
  • Morita S (2002) Pterostichine carabid beetles of the subgenus Cryobius (Coleoptera, Carabidae) from North Japan. Elytra 30: 73–89.
  • Müller-Kroehling S (2013) Zum Vorkommen moorspezifischer Laufkäfer (Coleoptera: Carabidae) und Schwimmkäfer (Dytiscidae) in Spirkenfilzen (FFH-Sub-LRT* 91D3) des Südschwarzwaldes als charakteristische Arten. Mitteilungen Badischer Landesverein für Naturkunde und Naturschutz e.V. 21: 283–302.
  • Müller-Motzfeld G (2004) Die Käfer Mitteleuropas, Band 2: Adephaga 1, Carabidae (Laufkäfer). Spektrum Akademischer Verlag, Elsevier.
  • Ober KA (2002) Phylogenetic relationships of the carabid subfamily Harpalinae (Coleoptera) based on molecular sequence data. Molecular Phylogenetics and Evolution 24: 228–248. https://doi.org/10.1016/S1055-7903(02)00251-8
  • Ortuño VM, Zaballos JP (1992) A new Haptoderus (Coleoptera: Caraboidea: Pterostichidae) from the Sierra de Ancares (Spain). The Coleopterists Bulletin 46: 337–342.
  • Pentinsaari M, Blagoev GA, Hogg ID, Levesque-Beaudin V, Perez K, Sobel CN, Vandenbrink B, Borisenko A (2020) A DNA Barcoding Survey of an Arctic Arthropod Community: Implications for Future Monitoring. Insects 11. https://doi.org/10.3390/insects11010046
  • Pizzolotto R, Gobbi M, Brandmayr P (2014) Changes in ground beetle assemblages above and below the treeline of the Dolomites after almost 30 years (1980/2009). Ecology and Evolution 4: 1284–1294. https://doi.org/10.1002/ece3.927
  • Polato NR, Gill BA, Shah AA, Gray MM, Casner KL, Barthelet A, Messer PW, Simmons MP, Guayasamin JM, Encalada AC, Kondratieff BC, Flecker AS, Thomas SA, Ghalambor CK, Poff NL, Funk WC, Zamudio KR (2018) Narrow thermal tolerance and low dispersal drive higher speciation in tropical mountains. Proceedings of the National Academy of Sciences 115: 12471–12476. https://doi.org/10.1073/pnas.1809326115
  • Pupier R (2011) Tribu Pterostichini – Subgen. Cryobius Chaudoir, 1838. In: Coulon G, Pupier R, Queinnec E, Ollivier E, Richoux P (Eds) Faune de France 95 – Coléoptères Carabiques. Faune de France, Paris, 443–455.
  • Raupach MJ, Astrin JJ, Hannig K, Peters MK, Stoeckle MY, Wägele J-W (2010) Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes. Frontiers in Zoology 7: 26. https://doi.org/10.1186/1742-9994-7-26
  • Rietze J (2001) Zur Phänologie ausgewählter Laufkäfer in baden-württembergischen Wäldern. Angewandte Carabidologie Supplement II Laufkäfer im Wald: 105–115.
  • Rulik B, Eberle J, von der Mark L, Thormann J, Jung M, Köhler F, Apfel W, Weigel A, Kopetz A, Köhler J, Fritzlar F, Hartmann M, Hadulla K, Schmidt J, Hörren T, Krebs D, Theves F, Eulitz U, Skale A, Rohwedder D, Kleeberg A, Astrin JJ, Geiger MF, Wägele JW, Grobe P, Ahrens D (2017) Using taxonomic consistency with semi-automated data pre-processing for high quality DNA barcodes. Methods in Ecology and Evolution 8: 1878–1887. https://doi.org/10.1111/2041-210X.12824
  • Sasakawa K (2009) Phylogeny and genital evolution of carabid beetles in the genus Pterostichus and its allied genera (Coleoptera: Carabidae) inferred from two nuclear gene sequences. Annals of the Entomological Society of America 100: 100–109. https://doi.org/10.1603/0013-8746(2007)100[100:PAGEOC]2.0.CO;2
  • Scheurig M, Hohner W, Weick D, Brechtel F, Beck L (1996) Laufkäferzönosen südwestdeutscher Wälder – Charakterisierung, Beurteilung und Bewertung von Standorten. Carolinea 54: 91–138.
  • Schmidt J, Opgenoorth L, Höll S, Bastrop R (2012) Into the Himalayan exile: the phylogeography of the ground beetle Ethira clade SUPPORTS the Tibetan origin of forest-dwelling Himalayan species groups. PLOS ONE 7: e45482. https://doi.org/10.1371/journal.pone.0045482
  • Schoville SD, Roderick GK, Kavanaugh DH (2012) Testing the ‘Pleistocene species pump’ in alpine habitats: lineage diversification of flightless ground beetles (Coleoptera: Carabidae: Nebria) in relation to altitudinal zonation. Biological Journal of the Linnean Society 107: 95–111. https://doi.org/10.1111/j.1095-8312.2012.01911.x
  • Serrano J (2013) Nuevo Catálogo de los Carabidae (Coleoptera) de la Península Ibérica. Editum. Ediciones de la Universidad de Murcia, 130 pp.
  • Shull GH (1948) What Is “Heterosis”? Genetics 33: 439–446.
  • Shull VL, Vogler AP, Baker MD, Maddison DR, Hammond PM (2001) Sequence alignment of 18S ribosomal RNA and the basal relationships of adephagan beetles: evidence for monophyly of aquatic families and the placement of Trachypachidae. Systematic Biology 50: 945–969.
  • Sikes DS, Bowser M, Morton JM, Bickford C, Meierotto S, Hildebrandt K (2017) Building a DNA barcode library of Alaska’s non-marine arthropods. Genome 60: 248–259. https://doi.org/10.1139/gen-2015-0203
  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651–701. https://doi.org/10.1093/aesa/87.6.651
  • Sommer C, Malz P, Seehaus TC, Lippl S, Zemp M, Braun MH (2020) Rapid glacier retreat and downwasting throughout the European Alps in the early 21st century. Nature Communications 11: 3209. https://doi.org/10.1038/s41467-020-16818-0
  • Staudacher K, Jonsson M, Traugott M (2016) Diagnostic PCR assays to unravel food web interactions in cereal crops with focus on biological control of aphids. Journal of Pest Science 89: 281–293. https://doi.org/10.1007/s10340-015-0685-8
  • Steinbauer MJ, Field R, Grytnes J-A, Trigas P, Ah-Peng C, Attorre F, Birks HJB, Borges PAV, Cardoso P, Chou C-H, Sanctis MD, de Sequeira MM, Duarte MC, Elias RB, Fernández-Palacios JM, Gabriel R, Gereau RE, Gillespie RG, Greimler J, Harter DEV, Huang T-J, Irl SDH, Jeanmonod D, Jentsch A, Jump AS, Kueffer C, Nogué S, Otto R, Price J, Romeiras MM, Strasberg D, Stuessy T, Svenning J-C, Vetaas OR, Beierkuhnlein C (2016) Topography-driven isolation, speciation and a global increase of endemism with elevation. Global Ecology and Biogeography 25: 1097–1107. https://doi.org/10.1111/geb.12469
  • Strodl M, Gereben-Krenn B-A, Krenn H (2007) In die dritte Dimension alpiner Lebensräume: Erfassung der Laufkäfer (Coleoptera, Carabidae) mit Subterranfallen. Carinthia II 197./117. Jahrgang: 341–350.
  • Sugawara Y, Ihara Y, Nakano T (2021) A new species of Cybaeus L. Koch, 1868 (Araneae, Cybaeidae) with simple genitalia from central Japan is the sister species of C. melanoparvus Kobayashi, 2006 with elongated genitalia. Zoosystematics and Evolution 97: 223–233. https://doi.org/10.3897/zse.97.64473
  • Tavaré S (1986) Some probabilistic and statistical problems in the analysis of DNA sequences. Lectures on Mathematics in the Life Sciences (American Mathematical Society) 17: 57–86.
  • Trautner J (2017) 1 Die Laufkäfer Baden-Württembergs. Eugen Ulmer, Stuttgart.
  • Trautwein MD, Wiegmann BM, Beutel R, Kjer KM, Yeates DK (2012) Advances in insect phylogeny at the dawn of the postgenomic era. Annual Review of Entomology 57: 449–468.
  • Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44: W232–W235. https://doi.org/10.1093/nar/gkw256
  • Weng Y-M, Yang M-M, Yeh W-B (2016) A comparative phylogeographic study reveals discordant evolutionary histories of alpine ground beetles (Coleoptera, Carabidae). Ecology and Evolution 6: 2061–2073. https://doi.org/10.1002/ece3.2006
  • Weng Y-M, Veire BM, Dudko RY, Medeiros MJ, Kavanaugh DH, Schoville SD (2020) Rapid speciation and ecological divergence into North American alpine habitats: the Nippononebria (Coleoptera: Carabidae) species complex. Biological Journal of the Linnean Society 130: 18–33. https://doi.org/10.1093/biolinnean/blaa014
  • Wiegmann BM, Trautwein MD, Kim J-W, Cassel BK, Bertone MA, Winterton SL, Yeates DK (2009) Single-copy nuclear genes resolve the phylogeny of the holometabolous insects. BMC Biology 7: 34. https://doi.org/10.1186/1741-7007-7-34
  • Will KW, Gill AS (2008) Phylogeny and classification of Hypherpes auctorum (Coleoptera: Carabidae: Pterostichini: Pterostichus). Annals of Carnegie Museum 77: 93–127. https://doi.org/10.2992/0097-4463-77.1.93
  • Woodcock TS, Boyle EE, Roughley RE, Kevan PG, Labbee RN, Smith ABT, Goulet H, Steinke D, Adamowicz SJ (2013) The diversity and biogeography of the Coleoptera of Churchill: insights from DNA barcoding. BMC Ecology 13: 40. https://doi.org/10.1186/1472-6785-13-40
  • Zhou Z, Wen J, Li G, Sun H (2012) Phylogenetic assessment and biogeographic analyses of tribe Peracarpeae (Campanulaceae). Plant Systematics and Evolution 298: 323–336. https://doi.org/10.1007/s00606-011-0547-7
  • Zinovyev EV (2007) A history of ground-beetle faunas of West Siberia and the Urals during the Late Pleistocene to Holocene. In: Back to the roots and back to the future. Towards a new synthesis amongst taxonomic, ecological and biogeographical approaches in carabidology. Proceedings of the XIII European Carabidologists Meeting, Blagoevgrad. 241–254.
  • Zubrii NA, Filippov BY, Kondakov AV, Khruleva OA, Rybalov LB, Vikhreva DV (2022) DNA barcoding versus morphological variability of Pterostichus brevicornis brevicornis (Kirby, 1837) (Coleoptera, Carabidae) in the Arctic and Subarctic. Insects 13: 204. https://doi.org/10.3390/insects13020204