Adult specimens of D. r. delanira (Figs 1A, 2), D. geraensis (Fig. 1B) and D. vertebralis (Fig. 1F, G, Supplementary Material 1) were examined from the following collections: AMNH, American Museum of Natural History, New York, New York, USA; CEIOC, Coleção Entomológica do Instituto Oswaldo Cruz, Instituto Oswaldo Cruz, Rio de Janeiro, Rio de Janeiro, Brazil; CGCM, Carlos Guilherme Costa Mielke research collection, Ponta Grossa, Paraná, Brazil; DZUP, Coleção Entomológica Pe. Jesus de Santiago Moure, Universidade Federal do Paraná, Curitiba, Paraná, Brazil; FLMNH, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, Gainesville, Florida, USA; MCZ, Museum of Comparative Zoology, Cambridge, Massachusetts, USA; MNRJ, Museu Nacional, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil; MZUSP, Museu de Zoologia, Universidade de São Paulo, São Paulo, Brazil; NBCN, Naturalis Biodiversity Center, Leiden, The Netherlands; NHMUK, The Natural History Museum, London, UK; NHMW, Naturhistorisches Museum Wien, Vienna, Austria; NHRS, Swedish Museum of Natural History, Stockholm, Sweden; RBINS, Royal Belgian Institute of Natural Sciences, Brussels, Belgium; USNM, Smithsonian Institution National Museum of Natural History, Washington, D.C., USA; ZMUC, Zoological Museum, University of Copenhagen, Copenhagen, Denmark; ZUEC, Coleção Zoológica do Museu de Diversidade Biológica da Universidade Estadual de Campinas, Campinas, São Paulo, Brazil (Table 1).

Figure 1. 

Adult Dasyophthalma species. A D. delanira stat. rest.; B D. geraensis; C D. rusina; D, E D. creusa, male and female, respectively; F, G D. vertebralis, male and female, respectively; in all pictures, dorsal view at left and ventral view at right. Scale bar = 1 cm.

Figure 2. 

Adult of Dasyophthalma delanira stat. rest. in Nova Friburgo, Rio de Janeiro state, Brazil. A Adult with closed wings perched on a leaf; B adult with open wings perched on a leaf (photos courtesy of Max Torres Peters).

Data from some collections were compiled from the Global Biodiversity Information Facility (GBIF) (https://www.gbif.org). Data from field observations were also compiled and divided in two categories: with and without photographs. Photographs of live specimens were also searched and found on two websites, iNaturalist (www.inaturalist.org), and Facebook (www.facebook.com), which provided useful data on the geographical distribution of these species. Data without photographs came from butterfly specialists (personal communication) (see Table 1). In addition, geographical data were also compiled from Freitas et al. (2018b) and Freitas et al. (2018c) (in these cases, data was not linked to voucher specimens). Geographical data from D. rusina (Fig. 1C) and D. creusa (Fig. 1D, E, Supplementary Material 1) came exclusively from the datasets of Santos et al. (2018) and Shirai et al. (2019) and also from the iNaturalist website (Fig. 3B, C). The dates of the records of D. creusa and D. rusina were searched on the iNaturalist website (see Rosa et al. 2023 for details).

Figure 3. 

Distribution map showing the known geographic distribution of Dasyophthalma species in Brazil. A Distribution of D. delanira, D. geraensis and D. vertebralis; B distribution of D. rusina; C distribution of D. creusa.

Geographical range (extent of occurrence EOO and area of occupancy AOO) was estimated based on all known sites for each species of Dasyophthalma. The EOO is the area contained within the shortest continuous imaginary boundary that includes all known distribution points of a species, and the AOO is the area within its EOO that is really occupied by a taxon (IUCN 2012; IUCN Standards and Petitions Committee 2022). Both EOO and AOO were estimated using the online open-source program GeoCAT (Geospatial Conservation Assessment Tool, available at http://geocat.kew.org) (Bachman et al. 2011). As recommended by IUCN for AOO analyses, a 2 km grid (cell area of 4 km²) was used (IUCN 2012; IUCN Standards and Petitions Committee 2022). Doubtful geographical data were not used in these analyses.

The mitochondrial cytochrome c oxidase subunit I (COI) and the nuclear glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and ribosomal protein S5 (RpS5) genes were selected for this study.

Total genomic DNA was purified from one or two legs per individual using the DNeasy Blood & Tissue Kit protocol (QIAGEN, Düsseldorf, Germany). DNA was stored in TE buffer at –20°. PCR amplification of cytochrome c oxidase subunit I (COI) partial sequences (ca. 658 bp) were performed using the LCO 1490 (Forward; 5’ GGTCAACAAATCATAAAGATATTGG) and HCO 2198 (Reverse; 5’ TAAACTTCAGGGTGACCAAAAAATCA) primers by Folmer et al. (1994). Reactions were done in 26 μL μL and contained 15,6 μL H₂O Milli-Q, 2,5 μl buffer solution (500 Mm KCl), 0,4 μL of dNTP (25 Mm), 2,0 μL of MgCl2 (2 Mm), 2,5 μL of DMSO 5%, 0,5 μL of each initiator (10 Mm), 0,2 μL of Taq DNA-Polymerase (Promega, Madison, WI, USA) (1 U), and 2,0 μL of DNA extracted. The amplification program included an initial denaturation step at 94°C for 2 min, followed by 34 cycles of denaturation at 94°C for 45s, annealing at 45°C for 45s, and polymerization at 72°C for 1 min, followed by an extension step at 72°C for 5 min (Silva-Brandão et al. 2005). PCR products were purified of primers and deoxynucleotides with ExoSAP-IT (GE Healthcare, Bucks, UK), and then sequenced by BigDye Kit protocol in an ABI 3500 automated sequencer, with primers used for amplification.

In the case of two specimens of D. vertebralis (voucher code: EB-19009 and EB-19033), DNA was extracted from old museum specimens deposited at the Natural History Museums at Stockholm and Copenhagen, respectively. The DNA extraction was carried out using QIAamp DNA MicroKit (QIAGEN®, USA) protocol, adapted with columns from MinElute PCR Purification Kit (QIAGEN®, Düsseldorf, Germany).

The standard steps for NGS library preparation (e.g., end repair, adaptor ligation and fill-in, and indexing PCR) were used, using Blunt-End Illumina Libraries, which consists in single index blunt-end Illumina library construction for ancient and historical samples, following a modified protocol of Meyer and Kircher (2010) as described in Twort et al. (2021). The pooled libraries were sent to sequencing at National Genomics Infrastructure (NGI) in Stockholm, Sweden on an Illumina NovaSeq machine.

All libraries were successfully sequenced using Whole Genome Shotgun Sequencing (WGSS) and the raw data were analyzed and each genome has been cleaned and assembled using de novo assembly techniques, as described in Twort et al. (2021). The COI and GAPDH genes were then successfully pooled from the two genomes and incorporated in the matrix.

Sequences generated in this work and from Matos-Maraví et al. (2021) were aligned with the sequences from COI and the nuclear genes GAPDH and RpS5 (Table 2 for accession numbers) using the program Geneious v. 11.1.5 (Kearse et al. 2012).

The concatenated matrix comprised three genes (mitochondrial COI and nuclear GAPDH and RpS5) and 88 specimens of 40 Satyrinae species (39 Brassolini and one Morphini, used to root the tree), representing all five Dasyophthalma species, with a total of 2,776 base pairs (COI – 1475bp; GAPDH – 691bp; RpS5 – 610bp) (see Table 2 for voucher numbers and information on the newly generated sequences). Data was partitioned by codon position and model selection (see Table 3 for details) was done using ModelFinder (Kalyaanamoorthy et al. 2017) with edge-linked partition model + FreeRate heterogeneity in IQ-TREE v. 2.1.2. (Minh et al. 2020) on CIPRES portal (Miller et al. 2010). The concatenated data set with aligned sequences is provided in the Supplementary Material (Supplementary Material 2).

The maximum likelihood tree was inferred using 10 independent likelihood searches in IQ-TREE v. 2.1.2, and support was calculated using the ultrafast bootstrap (UFBoot) (Hoang et al. 2018), with 2000 replications. In addition to assess node support through 1000 replications of Shimodaira Hasegawa-like approximate Likelihood Ratio Test (SH-aLRT) (-alrt 1000) (Guindon et al. 2010; Hoang et al. 2018) and Approximate Bayes test (aBayes) (Anisimova et al. 2011). The tree associated with the highest likelihood score (LnL = –16552.4484) was rooted as described above.

The genetic distances (Table 4) among species of Dasyophthalma were determined by using the nucleotide substitution model Kimura-2-parameters (Kimura 1980) by using the program MEGA X v.10.1.7 (Kumar et al. 2018).

A total of 28 adult specimens of D. r. delanira, 67 of D. geraensis and 26 of D. vertebralis were found in 16 public/private collections (Table 1). Data from field observations “without photographs” (pers. comm.) are two of D. r. delanira, and four of D. geraensis. Data “with photographs” came from Facebook, two of D. r. delanira, one of D. geraensis. Literature data (Freitas et al. 2018b,c) are three of D. vertebralis and 1 of D. geraensis. Data of D. creusa are 41 from datasets and 76 from iNaturalist and for D. rusina 34 from datasets and 27 from iNaturalist website.

The obtained molecular phylogeny (Fig. 4) recovered the genus Bia (subtribe Biina) as the sister group of all remaining Brassolini (subtribe Brassolina). In the subtribe Brassolina, five main clades were identified: 1) Narope + Opoptera (hereafter “Opoptera clade”) as the sister group of all remaining Brassolina; 2) Dynastor + Dasyophthalma (“Dasyophthalma clade”); 3) Caligo + Eryphanis (“Caligo clade”); 4) the genus Brassolis (“Brassolis clade”), as the sister group of 5) a large clade with all remaining genera (“Opsiphanes clade”). All brassoline genera were recovered as monophyletic, including Dasyophthalma, which have Dynastor darius as sister group. The two species groups of Dasyophthalma previously defined (Penz 2009) were also recovered as sister to each other: (1) the “creusa group”, including D. creusa + D. vertebralis, and (2) the “rusina-group”, including D. delanira stat. rest. + D. geraensis, this clade sister to D. rusina (Fig. 4).

Figure 4. 

Phylogenetic relationships of Dasyophthalma species and other Satyrinae taxa based on COI, GAPDH and RpS5 genes and obtained by a maximum likelihood analysis. Numbers near the nodes are SH-aLRT/aLRT/UFBoot support values.

Based on the COI, the mean K2P distance within species of Dasyophthalma was 0.017 (range 0 to 0.03), and the mean among species distance was 0.071 (range 0.02 to 0.10). The average distance between D. delanira stat. rest. and D. rusina varied from 0.05 to 0.07 (mean 0.056), and between D. delanira stat. rest. and D. geraensis was 0.02, both above the mean distance within species (Table 4).

In short, the present results recovered D. delanira stat. rest. as the sister species of D. geraensis, and this clade sister to D. rusina. This, combined with the genetic distances validate the decision of reinstating the specific status of the former, and not as a subspecies of D. rusina.

Based on the available geographical data, the genus Dasyophthalma is endemic from Brazil and has its distribution mostly in the Atlantic Forest domain, with only a few records in the Cerrado domain (Fig. 3). The most restricted species is D. delanira stat. rest., known from only four localities of well-preserved montane forest at altitudes above 1200 meters of two municipalities (Nova Friburgo and Cachoeiras de Macacu) in the Rio de Janeiro State (Fig. 3A, Table 1). Another high-altitude montane forest species, D. geraensis, was reported in 11 localities above 1000 meters of altitude along the Mantiqueira mountain range, in the states of Minas Gerais, São Paulo, and Rio de Janeiro (Figs 3A, 5C, D; Table 1). There is a single record of D. geraensis for the municipality of Castelo in the State of Espírito Santo that needs to be confirmed and could represent a mistake. The most enigmatic of the species of the genus is D. vertebralis; although the available data suggests a relatively wide distribution, in lowland Tableland forests in six localities in the states of Minas Gerais and Espírito Santo (Fig. 3A, Supplementary Material 1, Table 1), no individuals were observed since 1948, when two individuals were captured in Sooretama Biological Reserve, Espírito Santo State (Supplementary Material 1). In addition, the occurence of this species in the Brazilian state of Pará, in the Amazon region (mentioned in the original description) and in Iquitos (Peru), are both considered as mislabeled specimens (Freitas et al. 2018c). Two species, D. creusa and D. rusina, are common and show a wider geographical range, occurring in sympatry in great part of its distribution (Fig. 3B, C). However, D. rusina is more widespread and common in altitudes above 500 m, also occurring in forest areas within the Cerrado in Central Brazil (in Minas Gerais state and the Federal District), (Figs 3B, 5A, B), while D. creusa is more common on lowland coastal forests (on all states of Southeastern and South Brazil) (Figs 3C, 5A, B).

Figure 5. 

Habitat of D. rusina, D. creusa and D. geraensis in Itatiaia National Park (INP). A Closer view of D. rusina and D. creusa habitat; B general view of D. rusina and D. creusa habitat; C closer view of D. geraensis habitat; D general view of D. geraensis habitat.

Species of Dasyophthalma fly during the day, including the warmer hours (from 11:00 to 14:00), a pattern distinct of most Brassolini, which present crepuscular behavior (Brown 1992; Freitas et al. 1997; Casagrande and Mielke 2000, 2003). Adults are commonly observed in an erratic and fast flight in the forest understory, occasionally leaving to forest edges along rivers, dirty roads and trails. Based on all available data and field observations, all species of Dasyophthalma are univoltine, with adults flying during the summer months (records are mostly from December to March, with few records in November, April and May) (Table 1; see also Brown 1992; Penz 2009: Appendix 1; data from iNaturalist and personal observations of the authors also indicate the same flight period). Territorial behavior was not observed, and courtship behavior is unknown.

Some species occur in sympatry in several localities, such as D. creusa with D. rusina (Fig. 5A, B) and D. creusa with D. vertebralis (Supplementary Material 1). Others occurs in a parapatry as a result of different altitudinal preferences; the most notable example is D. rusina and D. delanira stat. rest., where the latter occurs in altitudes higher than the former, resulting in a very narrow line of sympatry around 1200–1300 m.

As most Brassolini, all species of Dasyophthalma belong to the fruit-feeding guild, and the most common species (i.e., D. creusa and D. rusina) are usually sampled in studies using traps baited with fermented fruits (e.g. Uehara-Prado et al. 2007), however, the other species in the genus are also potentially attracted to bait traps (Freitas and Marini-Filho, 2011; Freitas et al. 2018a, 2018b, 2018c). It is worth mentioning that fieldwork to sample D. vertebralis using attractive traps was carried out at Sooretama Biological Reserve on March 2020 without success (Supplementary Material 1). Also, a previous three-month sampling of fruit-feeding butterflies in the same area (April, July and August) captured only D. creusa in baited traps (Nogueira 2012).

Immature stages and host plants have been described (partially) only for the two most common species, D. creusa and D. rusina. For D. geraensis, its host plant “uricana/uricangas” (Bactris tormentosa, Arecaceae) is mentioned in some old studies, but immature stages are unknown (d‘Araújo e Silva et al. 1968; Zikán and Zikán 1940; Beccaloni et al. 2008). For D. creusa, the fourth and fifth instars and the pupa were described (Casagrande and Mielke 2003) and larvae were fed with Geonoma schottiana (Arecaeae) as host plant. Other host plants mentioned in the literature include “taquara” (Poaceae) (Hoffmann 1936), Astrocaryum aculeatum/vulgare? (Arecaceae) (Schmith and Hoffmann 1931) and Bactris sp. (Arecaceae) (Brown 1992). For D. rusina, the fifth instar and pupa were described, and its host plant is Geonoma schottiana (Arecaeae) (Casagrande & Mielke 2000). Other reported host plants include Euterpe edulis (Arecaceae) (Zikán and Zikán 1940; d‘Araújo e Silva et al. 1968) and Bambusa sp. (Poaceae) (d‘Araújo e Silva et al. 1968; Brown 1992).

Population data is limited and once again restricted to the two common and widespread species, D. creusa and D. rusina. Available data using baited traps reveal a large variation in number of sampled individuals in different areas. For example, for D. creusa, a minimum of one individual and a maximum of 81 individuals are reported in several short-term studies (Supplementary Material 1). For D. rusina, the few short-term studies sampled from one to 11 individuals (Table S1). In the only long-term study, in a montane area in southeastern Brazil, numbers were low, with only 35 individuals of D. creusa (30 males and five females) and three individuals of D. rusina (one male and two females) captured over 10 years of sampling (Supplementary Material 1).

As previously mentioned, three out of the five species of Dasyophthalma are of conservation importance, namely D. delanira stat. rest., D. geraensis and D. vertebralis (MMA 2003, 2014, 2022; Freitas et al. 2018a, 2018b, 2018c). In these three cases, the inclusions on the Brazilian Red list were all based on the IUCN B criterion (geographical range), since there is no data on population trends for them. The changes in the conservation status of each three species over time are shown in Table 5.

In addition of being on the national Red List, these three species were/are also listed on several regional Red lists, such as for the state of Minas Gerais (COPAN 1996; Casagrande et al. 1998; COPAN 2010), Espírito Santo (Espírito Santo 2005; Azevedo et al. 2007; Fraga et al. 2019), Rio de Janeiro (SEMA 1998; Otero et al. 2000), and São Paulo (São Paulo 2008, 2010, 2014, 2018).

However, for at least two threatened species of Dasyophthalma the situation is optimistic, since several known populations are located inside protected areas (PAs) (IUCN Protected Area Management Categories I–VI (I–V = fully protected areas, and VI “Protected area with sustainable use of natural resources”, see Dudley 2008)). For D. delanira stat. rest., all four known localities of occurrence are inside three protected areas (two in two PAs VI category and one in a fully PA) and for D. geraensis, all 11 localities of occurrence are inside four protected areas (seven in one PA VI category and four in three fully PAs). For D. vertebralis, however, only one out of the six known localities of occurrence is inside a fully protected area (Table 1).

Based on geographic distribution records, the geographical ranges (EOO and AOO) were estimated and are presented in Table 6. Based only on the thresholds in km² of the IUCN “B” criterion (geographic range), D. delanira stat. rest. and D. geraensis present values of EOO that would keep them as threatened by the subcriterion “B1”, the others present values greater than 30,000,00 km² and are not able to figure under “B1” (Table 6). However, the AOO threshold values would include all species under the sub-criterion “B2” (Table 6).

The present phylogeny recovered five main clades that exactly correspond to the ones obtained by Matos-Maraví et al. (2021) based also on molecular data. Accordingly, the “Dasyophthalma clade” corresponds to ‘clade A‘ of Matos-Maraví et al. (2021), the “Opoptera clade” corresponds to ‘clade B’, the “Caligo clade” corresponds to ‘clade C’, the “Opsiphanes clade” corresponds to ‘clade D’ and the “Brassolis clade” corresponds to an unnamed clade including only the genus Brassolis. The main difference is the position of the “Opoptera clade”; in the present study this clade is the sister group of all remaining Brassolina, a position occupied by the “Dasyophthalma clade” (as ‘clade A’) in Matos-Maraví et al. (2021). The results are also somewhat congruent with those presented by Penz et al. (2013), based on morphology. In that study, three out of the five main clades have correspondence with the present study, namely, the “Caligo clade”, the“Brassolis clade” and the “Opsiphanes clade”; the “Dasyophthalma clade” was not recovered, with Dynastor appearing as sister to Brassolis (Penz et al. 2013) and Dasyophthalma as sister to Opoptera in some analyses. Concerning the genus Dasyophthalma, the present results are virtually identical to those obtained in previous morphological and molecular studies, with two well supported clades (Penz 2009; Matos-Maraví et al. 2021), the “creusa-group” and the “rusina-group” (sensu Penz 2009). However, our study is the first to include samples of D. delanira stat. rest.

Penz (2009) presented a detailed description of the morphology of wings and genitalia of four species of Dasyophthalma (except D. delanira stat. rest.) and the monophyly of the “rusina-group” was supported by seven morphological synapomorphies: (1) dorsal forewings and hindwings with a blue iridescence below discal cell and on the submedial area, respectively; (2) dorsal forewings with yellow scales located inside cell R5 with bifid edge; (3) dorsal forewings of males without yellow markings across costal margin; (4) dorsal hindwings of males with a brown hairpencil at base of discal cell; (5) hindwings with brown androconial patch on Rs-M1; (6) ventral hindwings with postmedial band with well-defined edges; and (7) a presence of a small midline extension on the posterior portion of sterigma. Six out of the seven above synapomorphies are observed in Dasyophthalma delanira stat. rest. (the seventh was not observed since no females of D. delanira stat. rest. were available for the present study).

In addition, D. delanira stat. rest. can be distinguished from the other two species of the “rusina-group” by the following morphological characters: (1) dorsal forewings of males with postmedial yellow band broader than in D. geraensis and in D. rusina; and (2) dorsal hindwings with postmedial band broader than in D. rusina, and not as yellowish as in D. geraensis. The overall morphology of male genitalia is very similar to all species of the genus, but the valva has a dorsal row of spines slightly different to those illustrated by Penz (2009). However, the number and shape of the spines present high intraspecific variability, and since a single male specimen of D. delanira stat. rest. was available to study, this character was not analyzed in further details.

The genus Dasyophthalma can be considered of high conservation interest for three main reasons: (1) the genus is endemic to the Atlantic Forest, with very few records in riparian forests of the Cerrado savannas, (2) three out of the five described species are of conservation interest, and (3) these are large dayflying butterflies, with a large appeal to be used in citizen science. Accordingly, getting photographic records in social media or from butterfly watchers is relatively easy, since these large butterflies call attention when present (as can be seen in this work). The geographical data is abundant and covers possibly the actual geographic distribution of all five species, allowing adequate niche modelling (except maybe for D. delanira stat. rest.), including past and future scenarios. Moreover, most species in the genus present a strong potential to be used as models in studies of molecular population ecology and phylogeography in the Atlantic Forest.

However, as previously mentioned, there are few data on natural history for all species Dasyophthalma (except for the two more widespread species). A good start would be describing the early stages of all species in detail (including complementing data for D. rusina and D. creusa). As for other species of Brassolini, females easily oviposit in plastic bags with leaves of the host plants; this method resulted in dozens of fertilized eggs of D. creusa and D. rusina in previous attempts and larvae easily accepted leaves of the palm trees Bactris, Astrocarium and Euterpe (the records on bamboos need to be confirmed) (AVLF unpublished results). Accordingly, rearing the other three species relies only on obtaining wild-caught fertilized females.

An important action would be searching for additional localities for the three threatened species in the genus (as suggested in Freitas and Marini-Filho 2011) in order to improve the calculations of AOO and EOO. For D. delanira stat. rest., candidate areas are all in the hilltops above 1300 m in the area between Nova Friburgo, Casimiro de Abreu and Cachoeiras de Macacu (in the state of Rio de Janeiro). For D. geraensis, the recent records in the “Serra do Papagaio” in Alagoa municipality and Baependi municipality, both localities in the state of Minas Gerais, suggest that this species could be more widespread through the west slopes of the Mantiqueira mountain range, in some more drier and seasonal areas. Finally, for D. vertebralis it is very important to find any extant population within the potential geographical range; based on museum specimens, this species was last collected in 1948 (more than 80 years ago) and since then no additional individual or photo/image has been reported so far. The Sooretama Biological Reserve is the first candidate area, since the forests are virtually the same as when the two females have been collected there in 1948. Other candidate areas in the state of Espírito Santo include the lowland forests in the center of the state, in the vicinities of Santa Teresa and Santa Leopoldina and Cariacica, and some of the last larger forest remnants in the west, in region of Castelo, São Vicente and Burarama.