Research Article |
|
Corresponding author: Sana Sharifian ( sharifian_sana@yahoo.com ) Academic editor: Martin Schwentner
© 2023 Sana Sharifian, Ehsan Kamrani, Maria A. Nilsson, Hanieh Saeedi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Sharifian S, Kamrani E, Nilsson MA, Saeedi H (2023) Molecular barcoding of the Persian Gulf mangrove associated brachyuran crabs. Arthropod Systematics & Phylogeny 81: 889-896. https://doi.org/10.3897/asp.81.e96839
|
Brachyuran crabs constitute the dominant fauna in intertidal and supratidal coasts of mangrove forests. We sampled the most commonly occurring crab species from the biodiversity rich Persian Gulf mangrove forest. We identified crabs from Camptandriidae, Dotillidae, Ocypodidae, Macrophthalmidae, and Sesarmidae as the most common species in the sampled regions. Molecular barcoding was applied to determine 11 species (29 specimens) of the mangrove crabs. Two mitochondrial genes were used to barcode the specimens and these were included in a larger phylogenetic data set. Many of the analyzed species showed a close phylogenetic relationship with species from the Northern Arabian Sea. The results provide the first steps to study the genetic diversity of the mangrove crab community along the Iranian coasts to support protection and management of mangrove ecosystems and its associated taxa.
Crustacea, Camptandriidae, Dotillidae, Ocypodidae, Macrophthalmidae, Sesarmidae, 16S, COI, DNA barcoding, Persian Gulf.
Mangroves are inter-tidal ecosystems unique to the tropics and subtropics, which are habitat to many brackish organisms and have a high genetic diversity (
Establishing a comprehensive list of the aquatic species present in mangroves and estuaries is a critical step for the development of marine conservation programs. Unfortunately, data on the distribution and diversity of aquatic crab communities in mangrove forests are too scarce to provide basic knowledge for fisheries and conservation plans of the Persian Gulf’s mangrove ecosystems (
Mangrove forests are a fragmented habitat, where species occur as discrete local populations connected by the passive and active migration of individuals (
Specimens were collected between 2018 to 2019 from seven sites. These sites were selected where high densities of crabs were expected based on previous studies of mangrove crabs in the Persian Gulf (Fig.
Sampling was performed in three inter-tidal regions: high tidal, inter-tidal, and low tidal (
The pereiopods from 29 of the specimens from Camptandriidae (13 individuals), Dotillidae (8 individuals), Macrophthalmidae (2 individuals), Ocypodidae (4 individuals), and Sesarmidae (2 individuals) (Table S1) were stored in separate containers for further analysis. In the laboratory, purification of total DNA from muscle tissue was performed using the Spin-Column protocol or the QIAGEN DNA extraction kit (DNeasy Blood & Tissue Kit) according to the manufacturer’s specification. The quantity of the extracted DNA was measured using a DS-11 (DeNovix) spectrophotometry.
Published primers for the genes 16S (16Sar, 16Sbr) and COI (LCO1490, HCO2198 and COL14, COH6) were used for PCR (
| Primer name | Primer sequence | Reference |
| 16Sar | CGCCTGTTTATCAAAAACAT | ( |
| 16Sbr | CCGGTCTGAACTCAGATCACGT | ( |
| LCO1490 | GGTCAACAAATCATAAAGATATTGG | ( |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | ( |
| COL14 | GCTTGAGCTGGCATAGTAGG | Schubart and Huber, 2006 |
| COH6 | TADACTTCDGGRTGDCCAAARAAYCA | Schubart and Huber, 2006 |
The PCR was run under the following conditions: 16S: Initial denaturation: three minutes at 94°C, 40 cycles with 45 seconds at 94°C for denaturing, one minute at 48°C for annealing, and one minute at 72°C for elongation, followed by a final elongation of 10 minutes at 72°C. COI: initial denaturation: 5 minutes at 94°C, 40 cycles with 50 seconds at 94°C for denaturing, 70 seconds at 47–45°C for annealing, and one minute at 72°C for elongation and a final elongation at 10 minutes at 72°C.
The PCR products were visually evaluated on a 1% agarose gel. Successfully amplified PCR products were sequenced from both strands using the PCR primers on an ABI sequencer 3730 DNA analyzer (Applied Biosystems, Foster City, USA) by the laboratory center of the Senckenberg Biodiversity and Climate Research Centre Frankfurt (SBiK-F). The resulting sequences were analyzed with Geneious (1.1.0) (
Molecular analysis of the Persian Gulf crabs resulted in 49 new sequences (16S: 28 sequences / COI: 21 sequences) that have been deposited in GenBank (Table S2). Molecular analysis infers that these correspond to 11 species from five families. One species in Macrophthalmidae (Fig.
A phylogenetic reconstruction of grapsoid and ocypodoid crabs based on a concatenated alignment of CO1 and 16S sequences. Support values are listed at nodes (SH-aLRT support (%)/ultrafast bootstrap support (%)). Scale bar show substitutions per site. Red lines show specimens sampled from the Persian Gulf for this study. Crab images by Sharifian, 2019.
From the family Camptandriidae, we identified three species, Manningis arabicum, Nasima dotilliformis and Opusia indica, in the mangrove forests. We molecularly identified three of the 11 described Camptandriidae genera using the data sets. Nasima Manning, 1991 and Manningis Al-Khayat & Jones, 1996 are reconstructed as sister genera, while Opusia Ng, Rahayu & Naser, 2009 in our analysis is the sister genus to the other genera in Dotillidae; although, with low support values (64%/62%). The six individuals of Manningis arabicum from the different locations in the Persian Gulf (Qeshm Island (Soheili, Koweii, Peiposht and Fardis Park), Bandar Abbas (Suru coast), Bandar Khamir (Bandare e Pol)) grouped with two published individuals from Pakistan (Fig.
From Dotillidae we identified four species from three different genera (Ilyoplax Stimpson, 1858, Scopimera De Haan, 1833, and Dotilla Stimpson, 1858) (Fig.
From Macrophthalmidae only one genus was identified, Ilyograpsus Barnard, 1955. The species could not be determined to the species level using sequence and morphological data from two individuals. The species did not group with the congeneric I. rhizophorae Barnard, 1955 and I. nodulosus Sakai, 1983 (Fig.
Two species from Ocypodidae were collected, Austruca sindensis Alcock, 1900 and A. iranica Pretzmann, 1971. A. sindensis Alcock, 1900 from Qeshm (Soheili, Laft and Kuweii) and Bandar Abbas (Nayband) were clustered with sequences from the same species from Pakistan and Iraq (100%/100%) (Fig.
Only one species from Sesarmidae was collected, Parasesarma persicum. P. persicum collected from the Qeshm stations (Soheili) and Bandar Khamir (Bandar e Pol) in the Persian Gulf clustered (96%/100%) with the sequences of the same species from other areas (Nayband Bay, Bushehr) in the Persian Gulf (Fig.
Most mangrove forests around the world are currently being degraded for land-use types, threatening the biodiversity of the area, especially the endemic species (
The mangrove forests of the Iranian coasts of the Persian Gulf has a higher species richness of mangrove crabs, as well as a higher number of geographic distribution records, compared to its Southern coasts (
To assess the species diversity, mangrove crabs were sampled in the Persian Gulf from seven sites covering three inter-tidal regions. Molecular analysis of the collected individuals identified 11 species. The Persian Gulf harbors about 30 crab species that inhabit mangrove forests (
Our results from molecular barcoding analysis of 29 mangrove crab individuals highlight a phylogenetic relationship between Persian Gulf crabs and species from the waters of Pakistan. Previous molecular studies have shown that mangrove crabs have a planktonic larval stage that results in genetically homogeneous populations covering large regions (
Due to their underrepresentation in molecular studies the Persian Gulf mangrove crab community may harbour both cryptic as well as new species. We may have discovered a new species, Ilyograpsus sp. (Macrophthalmidae Dana, 1851). Ilyograpsus sp. does not cluster with the two other included species (I. rhizophorae and I. nodulosus) that occur in the Persian Gulf. However, the other three described Ilyograpsus species were not included in our molecular analysis. Ilyograpsus sp. form an isolated lineage in the phylogeny, suggesting that it is genetically distinct from the species in our taxon sampling. Further morphological and molecular analysis is needed to understand the taxonomic position of Ilyograpsus sp.
Our study provides for the first time molecular data of the most abundant mangrove crabs of the Persian Gulf, barcoding one third of the species occurring in this habitat. In general, mangrove crabs of the Persian Gulf were closely related to species and individuals from the waters of Pakistan. Future research is necessary to assess the population ecology of the mangrove crab fauna across the Indo-Pacific Ocean to determine the influence of biotic and abiotic factors on their genetic variation and distribution ranges.
We acknowledge and especially thank Prof. Dr. Angelika Brandt at Senckenberg Research Institute and Natural History Museum in Frankfurt for hosting the principal investigator and advising her for taxonomic identifications. We also thank Dr. Mendoza at National University of Singapore for his taxonomic advices and confirmation during this research. We also thank all the technicians (Bianca Trautwein and Heike Kappes), also Dr. Marianna Simoes and Dr. Torben Riehl for helping in phylogenetic analysis and other staff at Senckenberg Research Institute and Natural History Museum who helped and welcomed the principal investigator.
Figures S1–S8, Tables S1–S4
Data type: .pdf
Explanation note: Figure S1. Morphological features of Camptandriidae (Manningis arabicum and Nasima dotilliformis). — Figure S2. Morphological features of Camptandriidae (Opusia indica) and Sesarmidae (Parasesarma persicum). — Figure S3. Morphological features of Dotillidae (Ilyoplax frater and I. stevensi). — Figure S4. Morphological features of Dotillidae (Dotilla blanfordi and Scopimera bracricauda). — Figure S5. Morphological features of Macrophthalmidae (Ilyoplax sp.). — Figure S6. Morphological features of Ocypodidae (Austruca iranica and A. sindensis). — Figure S7. 16S phylogeny of Grapsoidae and Ocypodoidae. — Figure S8. COI phylogeny of Grapsoidae and Ocypodoidae.