Research Article
Print
Research Article
Molecular barcoding of the Persian Gulf mangrove associated brachyuran crabs
expand article infoSana Sharifian‡, Ehsan Kamrani§, Maria A. Nilsson|, Hanieh Saeedi|
‡ Iranian Fisheries Sciences Research Institute, Bandar Abbas, Iran
§ University of Hormozgan, Bandar Abbas, Iran
| Senckenberg Research Institute and Natural History Museum, Frankfurt am Main, Germany

Corresponding author: Sana Sharifian ( sharifian_sana@yahoo.com )

Academic editor: Martin Schwentner
© 2023 Sana Sharifian, Ehsan Kamrani, Maria A. Nilsson, Hanieh Saeedi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Sharifian S, Kamrani E, Nilsson MA, Saeedi H (2023) Molecular barcoding of the Persian Gulf mangrove associated brachyuran crabs. Arthropod Systematics & Phylogeny 81: 889-896. https://doi.org/10.3897/asp.81.e96839
ZooBank: urn:lsid:zoobank.org:pub:A589543C-EEC7-46D2-A615-39AF6341AFAC
Open Access

Abstract

Brachyuran crabs constitute the dominant fauna in intertidal and supratidal coasts of mangrove forests. We sampled the most commonly occurring crab species from the biodiversity rich Persian Gulf mangrove forest. We identified crabs from Camptandriidae, Dotillidae, Ocypodidae, Macrophthalmidae, and Sesarmidae as the most common species in the sampled regions. Molecular barcoding was applied to determine 11 species (29 specimens) of the mangrove crabs. Two mitochondrial genes were used to barcode the specimens and these were included in a larger phylogenetic data set. Many of the analyzed species showed a close phylogenetic relationship with species from the Northern Arabian Sea. The results provide the first steps to study the genetic diversity of the mangrove crab community along the Iranian coasts to support protection and management of mangrove ecosystems and its associated taxa.

Key words

Crustacea, Camptandriidae, Dotillidae, Ocypodidae, Macrophthalmidae, Sesarmidae, 16S, COI, DNA barcoding, Persian Gulf.

1. Introduction

Mangroves are inter-tidal ecosystems unique to the tropics and subtropics, which are habitat to many brackish organisms and have a high genetic diversity (Nagelkerken et al. 2008; Saeedi et al. 2018; Sharifian et al. 2021c, 2020, 2017; Walters et al. 2008). The mangrove ecosystem is one of the most important areas in terms of ecological and economic importance in protected areas, rich in swamps which control the tidal hydrodynamics, and in the production of fishery resources (Kathiresan and Bingham 2001, Nagelkerken et al. 2008, Zahed et al. 2010). Brachyuran crabs are one of the most dominant fauna in many mangrove forests in the Indo-Pacific area, making up about 80% of the macrofaunal biomass and can reach densities of 80-90 individuals m2 (Nagelkerken et al. 2008, Soundarapandian et al. 2008, Davie et al. 2015b, 2015a, Ngo-Massou et al. 2018). In the Persian Gulf, the burrowing crabs Ocypode Weber, 1795 and Uca Leach, 1814 were reported as the most abundant crabs in the mangrove coastal zone. The macrofaunal community of Persian Gulf mangroves showed temporal and spatial heterogeneity in species diversity and composition with higher taxonomic diversity at summer in the deltaic zone and vegetated habitats than the coastal zone and mudflats (Hajializadeh et al. 2020, 2022, Vahidi et al. 2020, Nozarpour et al. 2023), as well as differences in the distribution of abundant species and biological traits across all habitats of the Persian Gulf (Hajializadeh et al. 2020). In the Persian Gulf mangroves, macrofaunal communities were characterized by low diversity and low functional redundancy indicating low trait modalities such as morphological, physiological and behavioral characteristics (Delfan et al. 2021). Most of the mangrove crabs are directly dependent on mangrove ecosystems for their survival, shelter, and nutritional support (Sharifian et al. 2017, Ngo-Massou et al. 2018, Saeedi et al. 2018, Sharifian et al. 2021c). They play a significant role in formation of detritus, nutrient restoration, and dynamism of the mangrove ecosystem along with other organisms (Nagelkerken et al. 2008, Soundarapandian et al. 2008, Ngo-Massou et al. 2018).

Establishing a comprehensive list of the aquatic species present in mangroves and estuaries is a critical step for the development of marine conservation programs. Unfortunately, data on the distribution and diversity of aquatic crab communities in mangrove forests are too scarce to provide basic knowledge for fisheries and conservation plans of the Persian Gulf’s mangrove ecosystems (Naderloo 2017). The Persian Gulf has diverse and heterogeneous marine habitats with remarkably high biodiversity, especially in terms of brachyuran crabs (Naderloo, 2017; Naderloo et al., 2011). During our sampling in the northern Persian Gulf, we found mostly grapsoid and ocypodoid crabs as the most abundant. Hajializadeh et al. (2022) found Opusia indica Alcock, 1900, Manningis arabicum Jones & Clayton, 1983, and Nasima dotilliformis Alcock, 1900 as the dominant species in un-vegetated habitats and O. indica, M. arabicum, and Parasesarma persicum Naderloo & Schubart, 2010 as the dominant species in vegetated habitats of Persian Gulf mangroves. The highest species richness of grapsoid and ocypodoid crabs is along the Indo-West Pacific (Sharifian et al. 2020). Approximately 13.5% of the species richness in the Indian and western Pacific Ocean is contained in The Persian Gulf (Sharifian et al. 2020). Our previous studies indicated that most of the dominant crab species are endemic to the Persian Gulf and the Sea of Oman, and some of these mangrove crabs are vulnerable to habitat loss in future (Sharifian et al. 2021b). Grapsoid and ocypodoid crabs of the Persian Gulf have many commonalities in terms of environment and morphology (Sharifian et al. 2020, 2021b). This emphasizes the importance to systematically classify the Persian Gulf’s grapsoid and ocypodoid crabs using molecular methods.

Mangrove forests are a fragmented habitat, where species occur as discrete local populations connected by the passive and active migration of individuals (Dibacco et al. 2006, Ragionieri et al. 2010). The Iranian mangrove forests cover an estimated 93.37 km2 of shorelines (Zahed, 2010), despite this only two species of mangrove Avicennia marina Forssk. Vierh and Rhizophora mucronata Poir. are found in the Persian Gulf mangroves. These mangroves are known as one the most biodiverse marine ecosystems (Zahed et al. 2010). The mangrove forests of the Persian Gulf and Oman Sea have exhibited an increase in surface area from 64.12 to 197.46 km2 during 1977 to 2017 (Salehipour Milani 2018). Along the Iranian coasts, changes of mangrove area from 47.35 km2 in 1977 to 94.03 km2 in 2017 were reported (Salehipour Milani 2018). Naderloo (2017) reported a total of 37 families, 150 genera and almost 256 species of brachyuran crabs from the Persian Gulf of which about 30 species inhabit mangrove forest of this region. Mangrove crabs are known to have high larval dispersal potential and gene flow among geographically separated populations (Laurenzano et al. 2013, Fratini et al. 2016, Sharifian et al. 2020, 2021a). Molecular barcoding data, in particular, 16S and COI mitochondrial DNA gene regions (mtDNA) have been found to be useful to address the unresolved issues related to the population genetics and ecology of mangrove crabs (Ragionieri et al. 2010, Laurenzano et al. 2013, Shih et al. 2015, Fratini et al. 2016, Buranelli et al. 2019). In this study, we used DNA barcode sequences of the most abundant mangrove crabs in the Persian Gulf to identify and characterize the unique fauna of the mangrove forests. The sequences were also used to reconstruct phylogenetic trees to compare identities of species from Pakistan.

2. Material and Methods

2.1. Study area and sampling

Specimens were collected between 2018 to 2019 from seven sites. These sites were selected where high densities of crabs were expected based on previous studies of mangrove crabs in the Persian Gulf (Fig. 1) (Naderloo 2017; Naderloo et al. 2011). The sampling areas include various localities of mangrove forests along the tidal mud zones located in A) Qeshm Island: 1) Mangroves of Laft (26.88°N, 55.76°E), 2) Soheili (26.78°N, 55.76°E), 3) Fardis Park (26.71°N, 55.90°E), 4) Kuweii (26.94°N, 55.98°E), 5) Dargahan (26.96°N, 56.05°E), and 6) Peiposht (26.90°N, 55.88°E); B) Bandar Khamir: 7) Mangrove of Bandar e Pol (26.98°N 55.64°E) and ; C) Coasts of Bandar Abbas: 8) Suru Beach (27.15°N, 56.23°E), and 9) Nayband mangrove (27.18°N, 56.39°E) (Fig. 1).

Figure 1. 

Study area located in the Persian Gulf. A Qeshm Island: 1) Mangroves of Laft 2) Soheili, 3) Fardis Park, 4) Kuweii, 5) Dargahan, and 6) Peiposht. B Bandar Khamir: 7) Mangrove of Bandar e Pol. C Coasts of Bandar Abbas: 8) Suru Beach, and 9) Nayband mangrove.

Sampling was performed in three inter-tidal regions: high tidal, inter-tidal, and low tidal (Naderloo 2017; Naderloo et al. 2011; Sharifian et al. 2020). Specimens were collected mainly by hand and by sieving and digging in mud beds. All specimens were kept in 96% ethanol, and transferred to the Senckenberg Research Institute and Natural History Museum in Frankfurt, Germany, for molecular analysis. The specimens were morphologically identified (Barnes, 2010; Naderloo, 2017; Naderloo et al., 2011) and were examined and verified by Dr. Jose Christopher Mendoza (National University of Singapore). From the 70 specimens, 11 species from five families Camptandriidae Stimpson, 1858, Dotillidae Stimpson, 1858, Macrophthalmidae Dana, 1851, Ocypodidae Rafinesque, 1815, and Sesarmidae Dana, 1851 were morphologically identified (Figs S1–S6). Photos of specimens and their diagnostic characters were taken using a camera attached to a stereo microscope at the Senckenberg Research Institute and Natural History Museum in Frankfurt.

2.2. DNA extraction

The pereiopods from 29 of the specimens from Camptandriidae (13 individuals), Dotillidae (8 individuals), Macrophthalmidae (2 individuals), Ocypodidae (4 individuals), and Sesarmidae (2 individuals) (Table S1) were stored in separate containers for further analysis. In the laboratory, purification of total DNA from muscle tissue was performed using the Spin-Column protocol or the QIAGEN DNA extraction kit (DNeasy Blood & Tissue Kit) according to the manufacturer’s specification. The quantity of the extracted DNA was measured using a DS-11 (DeNovix) spectrophotometry.

2.3. PCR

Published primers for the genes 16S (16Sar, 16Sbr) and COI (LCO1490, HCO2198 and COL14, COH6) were used for PCR (Folmer et al. 1994; Palumbi et al. 1991; Schubart and Huber, 2006) (Table 1). For COI, both primer pairs were used. The primers from Folmer et al (1994) were used for the initial PCRs, if the amplification failed the modified primers COL14/COH6 were used.

Table 1.
Download as
CSV
XLSX

The primers used for amplification of 16S and COI.

Primer name Primer sequence Reference
16Sar CGCCTGTTTATCAAAAACAT (Palumbi et al., 1991)
16Sbr CCGGTCTGAACTCAGATCACGT (Palumbi et al., 1991)
LCO1490 GGTCAACAAATCATAAAGATATTGG (Folmer et al., 1994)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al., 1994)
COL14 GCTTGAGCTGGCATAGTAGG Schubart and Huber, 2006
COH6 TADACTTCDGGRTGDCCAAARAAYCA Schubart and Huber, 2006

The PCR was run under the following conditions: 16S: Initial denaturation: three minutes at 94°C, 40 cycles with 45 seconds at 94°C for denaturing, one minute at 48°C for annealing, and one minute at 72°C for elongation, followed by a final elongation of 10 minutes at 72°C. COI: initial denaturation: 5 minutes at 94°C, 40 cycles with 50 seconds at 94°C for denaturing, 70 seconds at 47–45°C for annealing, and one minute at 72°C for elongation and a final elongation at 10 minutes at 72°C.

2.4. Sequencing and data analysis

The PCR products were visually evaluated on a 1% agarose gel. Successfully amplified PCR products were sequenced from both strands using the PCR primers on an ABI sequencer 3730 DNA analyzer (Applied Biosystems, Foster City, USA) by the laboratory center of the Senckenberg Biodiversity and Climate Research Centre Frankfurt (SBiK-F). The resulting sequences were analyzed with Geneious (1.1.0) (Kearse et al. 2012). Quality control and trimming resulted in 49 sequences (28 from 16S/21 from COI) (Table S2). An additional 74 sequences of 16S, and 69 of COI sequences, from the five families, as well as Varunidae Milne Edwards, 1853 were selected from the NCBI database (see Tables S3 and S4 for details). The additional sequences were selected with the aim to analyse the relationship between the Persian Gulf species with species and individuals from other geographical regions. Three data sets were generated, one for COI, one for 16S, and a concatenated alignment for 16S and COI. Pseudocarcinus gigas Lamarck, 1818 (16S:HM637969/COI: HM638058) and Charybdis helleri Milne-Edwards, 1867 (16S:KX060527/COI: KX060332) were used as outgroups in the respective data sets. The data sets were aligned with MUSCLE (Edgar, 2004) in AliView (Larsson, 2014) and manually inspected. The molecular identification and barcoding of crabs were performed for all three data sets with Maximum Likelihood (ML) using IQ-TREE (http://iqtree.cibiv.univie.ac.at) (Nguyen et al. 2015, Trifinopoulos et al. 2016). ModelFinder, as implemented in IQ-TREE, identified the suitable evolutionary model for each data set (Kalyaanamoorthy et al. 2017). Branch support was calculated by 1000 bootstrap replicates of SH-aLRT as well as 1000 replicates of ultrafast bootstrap support (Hoang et al. 2018). Branches with SH-aLRT ≥ 80% and UFboot ≥ 95% were considered significant. FigTree 1.4.4 (available at http://tree.bio.ed.ac.uk/software/figtree) was used to visualize the resulting phylogenetic trees.

3. Results

Molecular analysis of the Persian Gulf crabs resulted in 49 new sequences (16S: 28 sequences / COI: 21 sequences) that have been deposited in GenBank (Table S2). Molecular analysis infers that these correspond to 11 species from five families. One species in Macrophthalmidae (Fig. 2) could not be determined to the species level. The species tentatively named Ilyograpsus sp. may represent a so far undescribed species that may be endemic to the Persian Gulf. The phylogenetic results showed most of the identified sequences grouped with published sequences from same species from Pakistan.

Figure 2. 

A phylogenetic reconstruction of grapsoid and ocypodoid crabs based on a concatenated alignment of CO1 and 16S sequences. Support values are listed at nodes (SH-aLRT support (%)/ultrafast bootstrap support (%)). Scale bar show substitutions per site. Red lines show specimens sampled from the Persian Gulf for this study. Crab images by Sharifian, 2019.

3.1. Camptandriidae

From the family Camptandriidae, we identified three species, Manningis arabicum, Nasima dotilliformis and Opusia indica, in the mangrove forests. We molecularly identified three of the 11 described Camptandriidae genera using the data sets. Nasima Manning, 1991 and Manningis Al-Khayat & Jones, 1996 are reconstructed as sister genera, while Opusia Ng, Rahayu & Naser, 2009 in our analysis is the sister genus to the other genera in Dotillidae; although, with low support values (64%/62%). The six individuals of Manningis arabicum from the different locations in the Persian Gulf (Qeshm Island (Soheili, Koweii, Peiposht and Fardis Park), Bandar Abbas (Suru coast), Bandar Khamir (Bandare e Pol)) grouped with two published individuals from Pakistan (Fig. 2; Figs S7, S8). Nasima dotilliformis from Qeshm Island (locations: Dargahan, Soheili, Laft), Bandar Abbas (Nayband), and Bandar Khamir (Bandar e Pol) formed a monophyletic clade with published individuals from Pakistan (support values 100%/100%) (Fig. 2; Figs S7, S8). Opusia indica from Bandar Abbas (Suru coasts) and Bandar Khamir (Bandare e Pol) grouped with published sequences from same species from Pakistan (100%/100%) (Fig. 2, Figs S7, S8).

3.2. Dotillidae

From Dotillidae we identified four species from three different genera (Ilyoplax Stimpson, 1858, Scopimera De Haan, 1833, and Dotilla Stimpson, 1858) (Fig. 2, Fig. S8). The two species from Ilyoplax, I. frater Kemp, 1919 and I. stevensi Kemp, 1919 were reconstructed as sister species (Fig. 2). Scopimera crabricauda Alcock, 1900 from Bandar Abbas (Suru coasts) clustered (97%/100%) with Scopimera sp. from Pakistan (Fig. 2; Figs S7, S8), and all analysed species/individuals from Scopimera form a monophyletic group. Dotilla blanfordi Alcock, 1900 from Bandar Abbas (Suru coasts) clusters with other species from Taiwan, Singapore, and Egypt (Fig. 2; Figs S7, S8).

3.3. Macrophthalmidae

From Macrophthalmidae only one genus was identified, Ilyograpsus Barnard, 1955. The species could not be determined to the species level using sequence and morphological data from two individuals. The species did not group with the congeneric I. rhizophorae Barnard, 1955 and I. nodulosus Sakai, 1983 (Fig. 2, Fig. S5) in the phylogeny. This potentially new species forms a long, genetically distinct lineage inside Macrophthalmidae. The two individuals of Ilyograpsus sp. form the sister group to Metaplax H. Milne Edwards, 1852 /Macrophthalmus Desmarest, 1823 (Fig. 2). The new species is different in the shape of carapace, second gonopod, and third maxilliped (Fig. S5) compared to the other two Persian Gulf species, I. rhizophorae Barnard, 1955 and I. nodulosus Sakai, 1983.

3.4. Ocypodidae

Two species from Ocypodidae were collected, Austruca sindensis Alcock, 1900 and A. iranica Pretzmann, 1971. A. sindensis Alcock, 1900 from Qeshm (Soheili, Laft and Kuweii) and Bandar Abbas (Nayband) were clustered with sequences from the same species from Pakistan and Iraq (100%/100%) (Fig. 2). Similarly, A. iranica from Qeshm (Kuweii) clustered with individuals of the same species from Pakistan (Fig. 2). Based on 16S sequences, the two A. iranica individuals (Persian Gulf) and the Pakistan individual (MG024475) had a pairwise sequence distance of 12%. For COI the sequence distance between the individuals from Pakistan and the Persian Gulf was less than 1% (MF614779) and may be a result of misidentified individuals.

3.5. Sesarmidae

Only one species from Sesarmidae was collected, Parasesarma persicum. P. persicum collected from the Qeshm stations (Soheili) and Bandar Khamir (Bandar e Pol) in the Persian Gulf clustered (96%/100%) with the sequences of the same species from other areas (Nayband Bay, Bushehr) in the Persian Gulf (Fig. 2; Figs S7, S8). The sequences from two species, Ilyoplax sp. and Ilyoplax frater, clustered inside the Sesarmidae instead of the Dotillidae in the COI phylogeny (Fig. S8). Most likely these COI sequences stem from misidentified species, likely Parasesarma persicum (Ilyoplax frater MK431533), or an unknown Parasesarma De Man, 1895 (Ilyoplax sp. MK503851).

4. Discussion

Most mangrove forests around the world are currently being degraded for land-use types, threatening the biodiversity of the area, especially the endemic species (Fratini et al. 2016, Richards and Friess 2016, Thomas et al. 2017). Future destruction may lead to the local extinction of species. As crabs are the dominant taxon of the mangrove community their habitat degradation may lead to disturbances of their ecological functions leading to negative effects on bioturbating, nutrient recycling, and microbial decomposition, as well as adverse lateral influence on the distribution, and abundance of tree species of mangrove forests (Alongi 2009, Buranelli et al. 2019, Sharifian et al. 2020, 2021b, 2021a).

The mangrove forests of the Iranian coasts of the Persian Gulf has a higher species richness of mangrove crabs, as well as a higher number of geographic distribution records, compared to its Southern coasts (Naderloo et al. 2013, Sharifian et al. 2021b). Despite the high diversity of mangrove crabs few studies have described and analyzed morphometric characteristics and sequence data from crabs in this region (Naderloo, 2017, 2011; Naderloo et al., 2011; Naderloo and Türkay, 2011), (Naderloo and Schubart, 2010; Naderloo and Schubart, 2009).

To assess the species diversity, mangrove crabs were sampled in the Persian Gulf from seven sites covering three inter-tidal regions. Molecular analysis of the collected individuals identified 11 species. The Persian Gulf harbors about 30 crab species that inhabit mangrove forests (Naderloo et al., 2011), thus our sampling covers about one third of the crab fauna in this habitat.

Our results from molecular barcoding analysis of 29 mangrove crab individuals highlight a phylogenetic relationship between Persian Gulf crabs and species from the waters of Pakistan. Previous molecular studies have shown that mangrove crabs have a planktonic larval stage that results in genetically homogeneous populations covering large regions (Ragionieri et al. 2010, Shih et al. 2015, Buranelli et al. 2019). However, the barcoding genes COI/16S are conserved and faster evolving markers are needed in order to analyze population structures between the Persian Gulf and Pakistan, if these exist.

Due to their underrepresentation in molecular studies the Persian Gulf mangrove crab community may harbour both cryptic as well as new species. We may have discovered a new species, Ilyograpsus sp. (Macrophthalmidae Dana, 1851). Ilyograpsus sp. does not cluster with the two other included species (I. rhizophorae and I. nodulosus) that occur in the Persian Gulf. However, the other three described Ilyograpsus species were not included in our molecular analysis. Ilyograpsus sp. form an isolated lineage in the phylogeny, suggesting that it is genetically distinct from the species in our taxon sampling. Further morphological and molecular analysis is needed to understand the taxonomic position of Ilyograpsus sp.

5. Conclusions

Our study provides for the first time molecular data of the most abundant mangrove crabs of the Persian Gulf, barcoding one third of the species occurring in this habitat. In general, mangrove crabs of the Persian Gulf were closely related to species and individuals from the waters of Pakistan. Future research is necessary to assess the population ecology of the mangrove crab fauna across the Indo-Pacific Ocean to determine the influence of biotic and abiotic factors on their genetic variation and distribution ranges.

6. Acknowledgements

We acknowledge and especially thank Prof. Dr. Angelika Brandt at Senckenberg Research Institute and Natural History Museum in Frankfurt for hosting the principal investigator and advising her for taxonomic identifications. We also thank Dr. Mendoza at National University of Singapore for his taxonomic advices and confirmation during this research. We also thank all the technicians (Bianca Trautwein and Heike Kappes), also Dr. Marianna Simoes and Dr. Torben Riehl for helping in phylogenetic analysis and other staff at Senckenberg Research Institute and Natural History Museum who helped and welcomed the principal investigator.

7. References

  • Alongi D (2009) Paradigm shifts in mangrove biology. Coastal Wetlands: An Integrated Ecosystem Approach: 615–640.
  • Barnes RSK (2010) A review of the sentinel and allied crabs (Crustacea: Brachyura: Macrophthalmidae), with particular reference to the genus Macrophthalmus. Raffles Bulletin of Zoology 58: 31–49.
  • Buranelli RC, Felder DL, Mantelatto FL (2019) Genetic diversity among populations of the Western Atlantic mangrove crab Ucides cordatus (Linnaeus, 1763) (Decapoda: Brachyura: Ocypodidae): evidence for panmixia and useful data for future management and conservation. Journal of Crustacean Biology 39: 386–395. https://doi.org/10.1093/jcbiol/ruz036
  • Davie PJF, Guinot D, Ng PKL (2015a) Phylogeny of Brachyura. The Crustacea; Complementary to the Volumes Translated From the French of the Traité de Zoologie. In: 9(C) (I), Decapoda: Brachyura (Part 2). , 921–979.
  • Delfan N, Shojaei MG, Naderloo R (2021) Patterns of structural and functional diversity of macrofaunal communities in a subtropical mangrove ecosystem. Estuarine, Coastal and Shelf Science 252: 107288. https://doi.org/10.1016/j.ecss.2021.107288
  • Dibacco C, Levin LA, Sala E (2006) Connectivity in marine ecosystems: the importance of larval and spore dispersal. In: Crooks KR, Sanjayan M (Eds) , Connectivity Conservation. Conservation Biology. Cambridge University Press, Cambridge, 184–212. https://doi.org/10.1017/CBO9780511754821.009
  • Folmer O. M, Black W, Hoeh RL, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Fratini S, Ragionieri L, Cannicci S (2016) Demographic History and Reproductive Output Correlates with Intraspecific Genetic Variation in Seven Species of Indo-Pacific Mangrove Crabs. PLOS ONE 11: e0158582. Available from: https://doi.org/10.1371/journal.pone.0158582.
  • Hajializadeh P, Safaie M, Naderloo R, Shojaei MG, Gammal J, Vil­lnäs A, Norkko A (2020) Species Composition and Functional Traits of Macrofauna in Different Mangrove Habitats in the Persian Gulf. Frontiers in Marine Science 7. https://doi.org/10.3389/fmars.2020.575480
  • Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the Ultrafast Bootstrap Approximation. Molecular biology and evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics (Oxford, England) 28: 1647–1649. https://doi.org/10.1093/bioinformatics/bts199
  • Laurenzano C, Mantelatto FLM, Schubart CD (2013) South American homogeneity versus Caribbean heterogeneity: population genetic structure of the western Atlantic fiddler crab Uca rapax (Brachyura, Ocypodidae). Journal of Experimental Marine Biology and Ecology 449: 22–27. https://doi.org/10.1016/j.jembe.2013.08.007
  • Naderloo R (2011) Grapsoid crabs (Decapoda: Brachyura: Thoracotremata) of the Persian Gulf and the Gulf of Oman. Zootaxa 3048: 1–43.
  • Naderloo R (2017) Atlas of Crabs of the Persian Gulf. Springer International Publishing, XXII, 444 pp.
  • Naderloo R, Schubart CD (2010) Description of a new species of Para­sesarma (Crustacea; Decapoda; Brachyura; Sesarmidae) from the Persian Gulf, based on morphological and genetic characteristics. Zoologischer Anzeiger – A Journal of Comparative Zoology 249: 33–43. https://doi.org/10.1016/j.jcz.2010.01.003
  • Naderloo R, Türkay M (2011) A new species of the Macrophthalmus boscii-group (Decapoda: Brachyura: Macrophthalmidae) from the Persian Gulf with designation of a Neotype for M. boscii Audouin (1826). Marine Biodiversity 41: 503–515. https://doi.org/10.1007/s12526-010-0077-5
  • Naderloo R, Türkay M, Sari A (2013) Intertidal habitats and decapod (Crustacea) diversity of Qeshm Island, a biodiversity hotspot within the Persian Gulf. Marine Biodiversity 43: 445–462. https://doi.org/10.1007/s12526-013-0174-3
  • Naderloo R, Schbart CD (2009) Redescription and mitochondrial identification of Chiromantes boulengeri (Calman, 1920) (Decapoda: Brachyura: Sesarmidae) based on fresh material from the Persian Gulf, Iran . Zootaxa; Vol 2128, No 1: 9 Jun. 2009. https://doi.org/10.­11­646/zootaxa.2128.1.3
  • Naderloo R, Turkay M, Apel M (2011) Brachyuran crabs of the family Macrophthalmidae Dana, 1851 (Decapoda: Brachyura: Macrophthalmidae) of the Persian Gulf . Zootaxa; Vol 2911, No 1: 9 Jun. 2011. https://doi.org/10.11646/zootaxa.2911.1.1
  • Nagelkerken I, Blaber SJM, Bouillon S, Green P, Haywood M, Kirton LG, Meynecke J-O, Pawlik J, Penrose HM, Sasekumar A, Somerfield PJ (2008) The habitat function of mangroves for terrestrial and marine fauna: A review. Aquatic Botany 89: 155–185. https://doi.org/10.1016/j.aquabot.2007.12.007
  • Ngo-Massou VM, Din N, Kenne M, Dongmo AB (2018) Brachyuran crab diversity and abundance patterns in the mangroves of Cameroon. Regional Studies in Marine Science 24: 324–335. https://doi.org/10.1016/j.rsma.2018.09.010
  • Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300
  • Nozarpour R, Shojaei MG, Naderloo R, Nasi F (2023) Crustaceans functional diversity in mangroves and adjacent mudflats of the Persian Gulf and Gulf of Oman. Marine Environmental Research 186: 105919. https://doi.org/10.1016/j.marenvres.2023.105919
  • Palumbi S. R. A, Martin S, Romano WO, Mcmillan L, Grabowski G (1991) The Simple Fool’s Guide to PCR. A Collection of PCR Protocols.
  • Ragionieri L, Cannicci S, Schubart CD, Fratini S (2010) Gene flow and demographic history of the mangrove crab Neosarmatium meinerti: A case study from the western Indian Ocean. Estuarine, Coastal and Shelf Science 86: 179–188. https://doi.org/10.1016/j.ecss.2009.11.002
  • Richards DR, Friess DA (2016) Rates and drivers of mangrove deforestation in Southeast Asia, 2000–2012. Proceedings of the National Academy of Sciences 113: 344–349. https://doi.org/10.1073/pnas.1510272113
  • Saeedi H, Kamrani E, Nordhaus I, Diele K (2018) Sediment Temperature Impact on Population Structure and Dynamics of the Crab Austruca iranica Pretzmann, 1971 (Crustacea: Ocypodidae) in Subtropical Mangroves of the Persian Gulf. Wetlands 38: 539–549. https://doi.org/10.1007/s13157-018-0998-5
  • Schubart CD, Huber MGJ (2006) Genetic Comparisons Of German Populations Of The Stone Crayfish, Austropotamobius torrentium (Crustacea: Astacidae) . Bull. Fr. Pêche Piscic.: 1019–1028. Available from: https://doi.org/10.1051/kmae:2006008
  • Sharifian S, Kamrani E, Saeedi H (2020) Global biodiversity and biogeography of mangrove crabs: Temperature, the key driver of latitudinal gradients of species richness. Journal of Thermal Biology 92: 102692. https://doi.org/10.1016/j.jtherbio.2020.102692
  • Sharifian S, Kamrani E, Saeedi H (2021b) Insights toward the future potential distribution of mangrove crabs in the Persian Gulf and the Sea of Oman. Journal of Zoological Systematics and Evolutionary Research 59: 1620–1631. https://doi.org/10.1111/jzs.12532
  • Sharifian S, Malekzadeh V, Kamrani E, Safaie M (2017) Population structure and morphometric variation in the sand-bubbler crab Scopimera crabricauda (Brachyura: Dotillidae). Animal Biology 67. https://doi.org/10.1163/15707563-00002539
  • Sharifian S, Malekzadeh V, Kamrani E, Safaie M (2021c) Growth and population biology of the sand-bubbler crab Scopimera crabricauda Alcock 1900 (Brachyura: Dotillidae) from the Persian Gulf, Iran. The Journal of Basic and Applied Zoology 82: 21. https://doi.org/10.1186/s41936-021-00218-x
  • Shih H-T, Saher NU, Kamrani E, Ng PKL, Lai Y-C, Liu M-Y (2015) Population genetics of the fiddler crab Uca sindensis (Alcock, 1900) (Crustacea: Brachyura: Ocypodidae) from the Arabian Sea. Zoological Studies 54: 1. https://doi.org/10.1186/s40555-014-0078-3
  • Soundarapandian P, Samuel SN, Kannupandi T. R (2008) Biodiversity of Crabs in Pichavaram Mangrove Environment, South East Coast of India. International Journal of Zoological Research 4: 113–118.
  • Thomas N, Lucas R, Bunting P, Hardy A, Rosenqvist A, Simard M (2017) Distribution and drivers of global mangrove forest change, 1996–2010. PLOS ONE 12: e0179302. Available from: https://doi.org/10.1371/journal.pone.0179302.
  • Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic acids research 44: W232-5. https://doi.org/10.1093/nar/gkw256
  • Vahidi F, Fatemi SMR, Danehkar A, Mashinchian A, Musavi Nadushan R (2020) Benthic macrofaunal dispersion within different mangrove habitats in Hara Biosphere Reserve, Persian Gulf. International Journal of Environmental Science and Technology 17: 1295–1306. https://doi.org/10.1007/s13762-019-02469-2
  • Walters BB, Rönnbäck P, Kovacs JM, Crona B, Hussain SA, Badola R, Primavera JH, Barbier E, Dahdouh-Guebas F (2008) Ethnobiology, socio-economics and management of mangrove forests: A review. Aquatic Botany 89: 220–236. https://doi.org/10.1016/j.aquabot.2008.02.009
  • Zahed MA, Rouhani F, Mohajeri S, Bateni F, Mohajeri L (2010) An overview of Iranian mangrove ecosystems, northern part of the Persian Gulf and Oman Sea. Acta Ecologica Sinica 30: 240–244. https://doi.org/10.1016/j.chnaes.2010.03.013

Supplementary material

Supplementary material 1 

Figures S1–S8, Tables S1–S4

Sharifian S, Kamrani E., Nilsson M, Saeedi H (2023)

Data type: .pdf

Explanation note: Figure S1. Morphological features of Camptandriidae (Manningis arabicum and Nasima dotilliformis). — Figure S2. Morphological features of Camptandriidae (Opusia indica) and Sesarmidae (Parasesarma persicum). — Figure S3. Morphological features of Dotillidae (Ilyoplax frater and I. stevensi). — Figure S4. Morphological features of Dotillidae (Dotilla blanfordi and Scopimera bracricauda). — Figure S5. Morphological features of Macrophthalmidae (Ilyoplax sp.). — Figure S6. Morphological features of Ocypodidae (Austruca iranica and A. sindensis). — Figure S7. 16S phylogeny of Grapsoidae and Ocypodoidae. — Figure S8. COI phylogeny of Grapsoidae and Ocypodoidae.

This dataset is made available under the Open Database License (http://opendatacommons.org/­licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (581.94 kb)
login to comment